| Basic Information ▶ | |
| VISDB ID | TVIS10043489 |
|---|---|
| Fusion Name | HBV-SPIRE1 integration |
| Validated | No |
| Curated Way | Curated |
| Method | HBV capture sequencing |
| Wet Assay | Yes |
| Sample ID | 80 |
| Sample Name | #080N |
| Sample Type | Tumor |
| Age | - |
| Gender | - |
| Disease Information ▶ | |
| Disease Name | - |
| Disease Abbreviation | - |
| Cancer | - |
| Literature ▶ | |
| PubMed ID | 33563643 |
| Journal | Gut |
| Published Year | 2021 |
| Human Genome ▶ | |
| Human Genome Version Description | GRCh37/hg19 |
| Human Genome RefSeq Accession | GCF_000001405.13 |
| Human Chromosome | chr18 |
| Cytogenetic Band | p11.21 |
| Human Strand | |
| Human Integration Location Type | intronic |
| Hg19 Start | 12622834 |
| Hg19 End | 12622834 |
| Hg38 Start | 12622835 |
| Hg38 End | 12622835 |
| Junction Sequence | TGTCTTGTGTTCCTACAGAC |
| Target Gene ▶ | |
| Target Gene | SPIRE1 |
| Nearby Gene | - |
| Distance | - |
| Virus Information ▶ | |
| Virus Name | Hepatitis B virus |
| Virus Subtype Name | HBV_D |
| Virus Genome Accession | X85254 |
| TaxonomyID | 10407 |
| Virus Abbreviation | HBV |
| Virus Genome | Hepatitis B virus genome (PreS1, PreS2, S, PreC, C, X genes and polymerase) |
| Virus Genome Length | 3182 bp |
| Virus Breakpoint1 | 1120 |
| Virus Breakpoint2 | - |
| Virus Gene Name | - |
| Virus Region Type | - |
| Integrated Virus Sequence | - |
| ViMIC ID | - |
| Predicted VIS Effect ▶ | |
| Gene Id | ENSG00000134278.17 |
| Gene Name | SPIRE1 |
| Region | intron |
| Impact | intronic_insertion |
| Transcript | Transcript 1: ENST00000409402.9, Transcript 2: ENST00000948128.1, Transcript 3: ENST00000410092.7, Transcript 4: ENST00000948125.1, Transcript 5: ENST00000948124.1, Transcript 6: ENST00000926393.1, Transcript 7: ENST00000926391.1, Transcript 8: ENST00000948127.1, Transcript 9: ENST00000926392.1, Transcript 10: ENST00000948126.1, Transcript 11: ENST00000309836.9, Transcript 12: ENST00000440472.6, Transcript 13: ENST00000453447.6, Transcript 14: ENST00000449797.5, Transcript 15: ENST00000497844.6, Transcript 16: ENST00000462226.1 |
| SpliceAI Score | |
| Delta Scores | Acceptor Gain: 0.000 | Acceptor Loss: 0.010 | Donor Gain: 0.010 | Donor Loss: 0.000 |
| Delta Score Max | 0.010 |
| Delta Position at Max | 2678 |
| Delta Score Flag | LOW |
| Gene | SPIRE1 |
| AlphaGenome Analysis | |
| Chromosome | chr18 |
Center for Precision Health
McWilliams School of Biomedical Informatics at UTHealth Houston
7000 Fannin Street, Suite 600, Houston, TX 77030
Email: Zhongming Zhao, Ph.D