| Basic Information ▶ | |
| VISDB ID | TVIS10043784 |
|---|---|
| Fusion Name | HBV-UBASH3B integration |
| Validated | No |
| Curated Way | Curated |
| Method | HBV capture sequencing |
| Wet Assay | Yes |
| Sample ID | 83 |
| Sample Name | #083N |
| Sample Type | Tumor |
| Age | - |
| Gender | - |
| Disease Information ▶ | |
| Disease Name | - |
| Disease Abbreviation | - |
| Cancer | - |
| Literature ▶ | |
| PubMed ID | 33563643 |
| Journal | Gut |
| Published Year | 2021 |
| Human Genome ▶ | |
| Human Genome Version Description | GRCh37/hg19 |
| Human Genome RefSeq Accession | GCF_000001405.13 |
| Human Chromosome | chr11 |
| Cytogenetic Band | q24.1 |
| Human Strand | |
| Human Integration Location Type | intronic |
| Hg19 Start | 122585527 |
| Hg19 End | 122585527 |
| Hg38 Start | 122714819 |
| Hg38 End | 122714819 |
| Junction Sequence | TGGAGACCACCGTGAACGCC |
| Target Gene ▶ | |
| Target Gene | UBASH3B |
| Nearby Gene | - |
| Distance | - |
| Virus Information ▶ | |
| Virus Name | Hepatitis B virus |
| Virus Subtype Name | HBV_D |
| Virus Genome Accession | X85254 |
| TaxonomyID | 10407 |
| Virus Abbreviation | HBV |
| Virus Genome | Hepatitis B virus genome (PreS1, PreS2, S, PreC, C, X genes and polymerase) |
| Virus Genome Length | 3182 bp |
| Virus Breakpoint1 | 1603 |
| Virus Breakpoint2 | - |
| Virus Gene Name | - |
| Virus Region Type | - |
| Integrated Virus Sequence | - |
| ViMIC ID | - |
| Predicted VIS Effect ▶ | |
| Gene Id | ENSG00000154127.10 |
| Gene Name | UBASH3B |
| Region | intron |
| Impact | intronic_insertion |
| Transcript | Transcript 1: ENST00000284273.6, Transcript 2: ENST00000525711.1, Transcript 3: ENST00000526386.5 |
| SpliceAI Score | |
| Delta Scores | Acceptor Gain: 0.240 | Acceptor Loss: 0.050 | Donor Gain: 0.200 | Donor Loss: 0.060 |
| Delta Score Max | 0.240 |
| Delta Position at Max | -93 |
| Delta Score Flag | HIGH_RECALL |
| Gene | UBASH3B |
| Altered Protein (FASTA) | |
| AlphaGenome Analysis | |
| Window | chr11:122649283-122780355 |
| RNA-seq Change (±2kb) | Mean: 0.00018488704517949373 | Peak: 0.109375 |
| ATAC Change (±2kb) | Mean: -0.0020929293241351843 | Peak: 5.00390625 |
| Interpretation | RNA-seq: minimal change 1.6% | Splice sites: no signal in region (REF≈0, ALT≈0) | ATAC: minimal change -3.1% |
| Visualization | |
Center for Precision Health
McWilliams School of Biomedical Informatics at UTHealth Houston
7000 Fannin Street, Suite 600, Houston, TX 77030
Email: Zhongming Zhao, Ph.D