| Basic Information ▶ | |
| VISDB ID | TVIS10047484 |
|---|---|
| Fusion Name | HBV-EIF1B-AS1 integration |
| Validated | No |
| Curated Way | Curated |
| Method | HBV capture sequencing |
| Wet Assay | Yes |
| Sample ID | 3338 |
| Sample Name | #3338N |
| Sample Type | Tumor |
| Age | - |
| Gender | - |
| Disease Information ▶ | |
| Disease Name | - |
| Disease Abbreviation | - |
| Cancer | - |
| Literature ▶ | |
| PubMed ID | 33563643 |
| Journal | Gut |
| Published Year | 2021 |
| Human Genome ▶ | |
| Human Genome Version Description | GRCh37/hg19 |
| Human Genome RefSeq Accession | GCF_000001405.13 |
| Human Chromosome | chr3 |
| Cytogenetic Band | p22.1 |
| Human Strand | |
| Human Integration Location Type | intronic |
| Hg19 Start | 40404552 |
| Hg19 End | 40404552 |
| Hg38 Start | 40363061 |
| Hg38 End | 40363061 |
| Junction Sequence | TAGCCTCACATTTCTAAATA |
| Target Gene ▶ | |
| Target Gene | EIF1B-AS1 |
| Nearby Gene | - |
| Distance | - |
| Virus Information ▶ | |
| Virus Name | Hepatitis B virus |
| Virus Subtype Name | HBV_D |
| Virus Genome Accession | X85254 |
| TaxonomyID | 10407 |
| Virus Abbreviation | HBV |
| Virus Genome | Hepatitis B virus genome (PreS1, PreS2, S, PreC, C, X genes and polymerase) |
| Virus Genome Length | 3182 bp |
| Virus Breakpoint1 | 1821 |
| Virus Breakpoint2 | - |
| Virus Gene Name | - |
| Virus Region Type | - |
| Integrated Virus Sequence | - |
| ViMIC ID | - |
Center for Precision Health
McWilliams School of Biomedical Informatics at UTHealth Houston
7000 Fannin Street, Suite 600, Houston, TX 77030
Email: Zhongming Zhao, Ph.D