| Basic Information ▶ | |
| VISDB ID | TVIS10048660 |
|---|---|
| Fusion Name | HBV-LINC00426 integration |
| Validated | No |
| Curated Way | Curated |
| Method | HBV capture sequencing |
| Wet Assay | Yes |
| Sample ID | 4131 |
| Sample Name | #4131T |
| Sample Type | Tumor |
| Age | - |
| Gender | - |
| Disease Information ▶ | |
| Disease Name | Hepatocellular carcinoma |
| Disease Abbreviation | HCC |
| Cancer | Yes |
| Literature ▶ | |
| PubMed ID | 33563643 |
| Journal | Gut |
| Published Year | 2021 |
| Human Genome ▶ | |
| Human Genome Version Description | GRCh37/hg19 |
| Human Genome RefSeq Accession | GCF_000001405.13 |
| Human Chromosome | chr13 |
| Cytogenetic Band | q12.3 |
| Human Strand | |
| Human Integration Location Type | intronic |
| Hg19 Start | 30934520 |
| Hg19 End | 30934520 |
| Hg38 Start | 30360383 |
| Hg38 End | 30360383 |
| Junction Sequence | GTCCTTTTTCTCTTGTGGGG |
| Target Gene ▶ | |
| Target Gene | LINC00426 |
| Nearby Gene | - |
| Distance | - |
| Virus Information ▶ | |
| Virus Name | Hepatitis B virus |
| Virus Subtype Name | HBV_D |
| Virus Genome Accession | X85254 |
| TaxonomyID | 10407 |
| Virus Abbreviation | HBV |
| Virus Genome | Hepatitis B virus genome (PreS1, PreS2, S, PreC, C, X genes and polymerase) |
| Virus Genome Length | 3182 bp |
| Virus Breakpoint1 | 1180 |
| Virus Breakpoint2 | - |
| Virus Gene Name | - |
| Virus Region Type | - |
| Integrated Virus Sequence | - |
| ViMIC ID | - |
| Predicted VIS Effect ▶ | |
| Gene Id | ENSG00000238121.9 |
| Gene Name | LINC00426 |
| Region | intron |
| Impact | intronic_insertion |
| Transcript | Transcript 1: ENST00000718390.1, Transcript 2: ENST00000850858.1, Transcript 3: ENST00000420210.6, Transcript 4: ENST00000718391.1, Transcript 5: ENST00000447147.5, Transcript 6: ENST00000657545.1, Transcript 7: ENST00000654979.1, Transcript 8: ENST00000718392.1, Transcript 9: ENST00000417079.5, Transcript 10: ENST00000429808.5, Transcript 11: ENST00000420219.5, Transcript 12: ENST00000450327.5 |
| AlphaGenome Analysis | |
| Window | chr13:30294847-30425919 |
| RNA-seq Change (±2kb) | Mean: 0.00032519950764253736 | Peak: 0.27734375 |
| ATAC Change (±2kb) | Mean: -0.0002623292675707489 | Peak: 3.00341796875 |
| Interpretation | RNA-seq: no signal in region (REF≈0, ALT≈0) | Splice sites: no signal in region (REF≈0, ALT≈0) | ATAC: minimal change -1.1% |
| Visualization | |
Center for Precision Health
McWilliams School of Biomedical Informatics at UTHealth Houston
7000 Fannin Street, Suite 600, Houston, TX 77030
Email: Zhongming Zhao, Ph.D