| Basic Information ▶ | |
| VISDB ID | TVIS10050941 |
|---|---|
| Fusion Name | HBV-MYO18B integration |
| Validated | No |
| Curated Way | Curated |
| Method | EBV capture sequencing, followed by Viral Integration Pathway Analysis (VIPA) pipeline |
| Wet Assay | No |
| Sample ID | SRR3104834.33 |
| Sample Name | SRA335342 |
| Sample Type | Tumor |
| Age | - |
| Gender | - |
| Disease Information ▶ | |
| Disease Name | Hepatocellular carcinoma |
| Disease Abbreviation | HCC |
| Cancer | Yes |
| Literature ▶ | |
| PubMed ID | 35968887 |
| Journal | Clinical and Translational Medicine |
| Published Year | 2022 |
| Human Genome ▶ | |
| Human Genome Version Description | GRCh38/hg38 |
| Human Genome RefSeq Accession | GCF_000001405.40 |
| Human Chromosome | chr22 |
| Cytogenetic Band | q12.1 |
| Human Strand | + |
| Human Integration Location Type | intronic |
| Hg19 Start | - |
| Hg19 End | - |
| Hg38 Start | 25803859 |
| Hg38 End | 25803859 |
| Junction Sequence | GGTCCTAGGAATCCTGATGTTGTGTTCTCCATGTTCGGTGCAGGGTCCCCAGTCCTCTCTTAAACTTCTAGCCAATTACTCTGAACTTGTTGGGGTTTAC |
| Target Gene ▶ | |
| Target Gene | MYO18B |
| Nearby Gene | - |
| Distance | - |
| Virus Information ▶ | |
| Virus Name | Hepatitis B virus |
| Virus Subtype Name | - |
| Virus Genome Accession | AB014381 |
| TaxonomyID | 10407 |
| Virus Abbreviation | HBV |
| Virus Genome | Hepatitis B virus 22Y04HCC genomic DNA, complete sequence |
| Virus Genome Length | 3215 bp |
| Virus Breakpoint1 | 130 |
| Virus Breakpoint2 | - |
| Virus Gene Name | P,S |
| Virus Region Type | - |
| Integrated Virus Sequence | - |
| ViMIC ID | - |
| Predicted VIS Effect ▶ | |
| Gene Id | ENSG00000133454.16 |
| Gene Name | MYO18B |
| Region | intron |
| Impact | intronic_insertion |
| Transcript | Transcript 1: ENST00000536101.5, Transcript 2: ENST00000335473.12, Transcript 3: ENST00000407587.6, Transcript 4: ENST00000539302.5, Transcript 5: ENST00000418374.6 |
| SpliceAI Score | |
| Delta Scores | Acceptor Gain: 0.000 | Acceptor Loss: 0.000 | Donor Gain: 0.000 | Donor Loss: 0.010 |
| Delta Score Max | 0.010 |
| Delta Position at Max | 570 |
| Delta Score Flag | LOW |
| Gene | MYO18B |
| AlphaGenome Analysis | |
| Window | chr22:25738323-25869395 |
| RNA-seq Change (±2kb) | Mean: -0.00020596505783032626 | Peak: 0.2666015625 |
| ATAC Change (±2kb) | Mean: -0.00024921962176449597 | Peak: 2.25634765625 |
| Interpretation | RNA-seq: no signal in region (REF≈0, ALT≈0) | Splice sites: no signal in region (REF≈0, ALT≈0) | ATAC: minimal change -0.9% |
| Visualization | |
Center for Precision Health
McWilliams School of Biomedical Informatics at UTHealth Houston
7000 Fannin Street, Suite 600, Houston, TX 77030
Email: Zhongming Zhao, Ph.D