| Basic Information ▶ | |
| VISDB ID | TVIS10051584 |
|---|---|
| Fusion Name | HBV-CD302 integration |
| Validated | No |
| Curated Way | Curated |
| Method | EBV capture sequencing, followed by Viral Integration Pathway Analysis (VIPA) pipeline |
| Wet Assay | No |
| Sample ID | SRR3104999.1 |
| Sample Name | SRA335342 |
| Sample Type | Tumor |
| Age | - |
| Gender | - |
| Disease Information ▶ | |
| Disease Name | Hepatocellular carcinoma |
| Disease Abbreviation | HCC |
| Cancer | Yes |
| Literature ▶ | |
| PubMed ID | 35968887 |
| Journal | Clinical and Translational Medicine |
| Published Year | 2022 |
| Human Genome ▶ | |
| Human Genome Version Description | GRCh38/hg38 |
| Human Genome RefSeq Accession | GCF_000001405.40 |
| Human Chromosome | chr2 |
| Cytogenetic Band | q24.2 |
| Human Strand | + |
| Human Integration Location Type | intronic |
| Hg19 Start | - |
| Hg19 End | - |
| Hg38 Start | 159772414 |
| Hg38 End | 159772414 |
| Junction Sequence | CCCGCCTTCCAAAGAGTATGTAAATAATGTTACATTATTGAGGTTTAATGGTTCACCTGGCTTTGGGGATTTAAGATTTGTTTAACTGAAAAAAACACCA |
| Target Gene ▶ | |
| Target Gene | CD302, LY75-CD302 |
| Nearby Gene | - |
| Distance | - |
| Virus Information ▶ | |
| Virus Name | Hepatitis B virus |
| Virus Subtype Name | - |
| Virus Genome Accession | AB033554 |
| TaxonomyID | 10407 |
| Virus Abbreviation | HBV |
| Virus Genome | Hepatitis B virus DNA, complete genome, isolate:RTB299 |
| Virus Genome Length | 3215 bp |
| Virus Breakpoint1 | 2741 |
| Virus Breakpoint2 | - |
| Virus Gene Name | P |
| Virus Region Type | - |
| Integrated Virus Sequence | - |
| ViMIC ID | - |
Center for Precision Health
McWilliams School of Biomedical Informatics at UTHealth Houston
7000 Fannin Street, Suite 600, Houston, TX 77030
Email: Zhongming Zhao, Ph.D