| Basic Information ▶ | |
| VISDB ID | TVIS10052052 |
|---|---|
| Fusion Name | HBV-UGGT2 integration |
| Validated | No |
| Curated Way | Curated |
| Method | EBV capture sequencing, followed by Viral Integration Pathway Analysis (VIPA) pipeline |
| Wet Assay | No |
| Sample ID | SRR3105065.3 |
| Sample Name | SRA335342 |
| Sample Type | Tumor |
| Age | - |
| Gender | - |
| Disease Information ▶ | |
| Disease Name | Hepatocellular carcinoma |
| Disease Abbreviation | HCC |
| Cancer | Yes |
| Literature ▶ | |
| PubMed ID | 35968887 |
| Journal | Clinical and Translational Medicine |
| Published Year | 2022 |
| Human Genome ▶ | |
| Human Genome Version Description | GRCh38/hg38 |
| Human Genome RefSeq Accession | GCF_000001405.40 |
| Human Chromosome | chr13 |
| Cytogenetic Band | q32.1 |
| Human Strand | + |
| Human Integration Location Type | intronic |
| Hg19 Start | - |
| Hg19 End | - |
| Hg38 Start | 95987119 |
| Hg38 End | 95987119 |
| Junction Sequence | TTCTCCTTTAGCTTAAGGACAGGATACTCACCCCACCACACGGCGGTCTTTTGGGGTGGAGCCCTCAGGCTCAGGACATATTGACAACAGTGCCAGCAGC |
| Target Gene ▶ | |
| Target Gene | UGGT2 |
| Nearby Gene | - |
| Distance | - |
| Virus Information ▶ | |
| Virus Name | Hepatitis B virus |
| Virus Subtype Name | - |
| Virus Genome Accession | AB014381 |
| TaxonomyID | 10407 |
| Virus Abbreviation | HBV |
| Virus Genome | Hepatitis B virus 22Y04HCC genomic DNA, complete sequence |
| Virus Genome Length | 3215 bp |
| Virus Breakpoint1 | 3047 |
| Virus Breakpoint2 | - |
| Virus Gene Name | P,S |
| Virus Region Type | - |
| Integrated Virus Sequence | - |
| ViMIC ID | - |
| Predicted VIS Effect ▶ | |
| Gene Id | ENSG00000102595.23 |
| Gene Name | UGGT2 |
| Region | intron |
| Impact | intronic_insertion |
| Transcript | Transcript 1: ENST00000376747.8, Transcript 2: ENST00000940279.1, Transcript 3: ENST00000940278.1, Transcript 4: ENST00000940277.1, Transcript 5: ENST00000943428.1, Transcript 6: ENST00000943429.1, Transcript 7: ENST00000940280.1, Transcript 8: ENST00000943427.1, Transcript 9: ENST00000943426.1, Transcript 10: ENST00000943425.1, Transcript 11: ENST00000943423.1, Transcript 12: ENST00000943424.1, Transcript 13: ENST00000465196.5, Transcript 14: ENST00000376714.7, Transcript 15: ENST00000461329.5, Transcript 16: ENST00000397618.7, Transcript 17: ENST00000467305.1 |
| SpliceAI Score | |
| Delta Scores | Acceptor Gain: 0.000 | Acceptor Loss: 0.090 | Donor Gain: 0.040 | Donor Loss: 0.060 |
| Delta Score Max | 0.090 |
| Delta Position at Max | 2954 |
| Delta Score Flag | LOW |
| Gene | UGGT2 |
| AlphaGenome Analysis | |
| Chromosome | chr13 |
Center for Precision Health
McWilliams School of Biomedical Informatics at UTHealth Houston
7000 Fannin Street, Suite 600, Houston, TX 77030
Email: Zhongming Zhao, Ph.D