| Basic Information ▶ | |
| VISDB ID | TVIS20000140 |
|---|---|
| Fusion Name | HPV-chr20:q13.2 integration |
| Validated | Yes |
| Curated Way | VISDB1.0 |
| Method | PCR and Sanger sequencing |
| Wet Assay | Yes |
| Sample ID | T11 |
| Sample Name | T11 |
| Sample Type | Tumor |
| Age | - |
| Gender | - |
| Disease Information ▶ | |
| Disease Name | Cervical carcinoma |
| Disease Abbreviation | CC |
| Cancer | Yes |
| Literature ▶ | |
| PubMed ID | 26735580 |
| Journal | Oncotarget |
| Published Year | 2016 |
| Human Genome ▶ | |
| Human Genome Version Description | GRCh37/hg19 |
| Human Genome RefSeq Accession | GCF_000001405.13 |
| Human Chromosome | chr20 |
| Cytogenetic Band | q13.2 |
| Human Strand | |
| Human Integration Location Type | - |
| Hg19 Start | 53582110 |
| Hg19 End | 53582110 |
| Hg38 Start | 54965571 |
| Hg38 End | 54965571 |
| Junction Sequence | - |
| Target Gene ▶ | |
| Target Gene | - |
| Nearby Gene | - |
| Distance | - |
| Virus Information ▶ | |
| Virus Name | Human Papillomavirus |
| Virus Subtype Name | HPV58 |
| Virus Genome Accession | NC_001357.1 |
| TaxonomyID | 10566 |
| Virus Abbreviation | HPV |
| Virus Genome | Human papillomavirus - 18, complete genome |
| Virus Genome Length | 7857 |
| Virus Breakpoint1 | 2195 |
| Virus Breakpoint2 | - |
| Virus Gene Name | - |
| Virus Region Type | E1 |
| Integrated Virus Sequence | AATATGCCTTATTAGCAGACAGCAACAGCAATGC AGCTGCCTTTTTAAAAAGCAATTGCCAAGCTAAATATTTAAAAGATTGTGCCACAATGTGCAAAC| |ATTAT AGGCGAGCCCAAAAACGACAAATGAATATGTCACAGTGGATACGATTTAGATGTTCAAAAATAGATGAAG GGGGAGATTGGAGACCAATAGTG |
| ViMIC ID | - |
Center for Precision Health
McWilliams School of Biomedical Informatics at UTHealth Houston
7000 Fannin Street, Suite 600, Houston, TX 77030
Email: Zhongming Zhao, Ph.D