| Basic Information ▶ | |
| VISDB ID | TVIS20003816 |
|---|---|
| Fusion Name | HPV-TRMO integration |
| Validated | Yes |
| Curated Way | VISDB1.0 |
| Method | Amplification of Papillomavirus Oncogene Transcripts (APOT) |
| Wet Assay | Yes |
| Sample ID | UPCI:SCC152 |
| Sample Name | UPCI:SCC152 |
| Sample Type | Cell line |
| Age | - |
| Gender | - |
| Disease Information ▶ | |
| Disease Name | Head and neck squamous cell carcinoma |
| Disease Abbreviation | HNSCC |
| Cancer | Yes |
| Literature ▶ | |
| PubMed ID | 25082736 |
| Journal | Int J Cancer |
| Published Year | 2015 |
| Human Genome ▶ | |
| Human Genome Version Description | GRCh37.p5 |
| Human Genome RefSeq Accession | GCF_000001405.17 |
| Human Chromosome | chr9 |
| Cytogenetic Band | q22.33 |
| Human Strand | - |
| Human Integration Location Type | Intron2 |
| Hg19 Start | 100676842 |
| Hg19 End | 100676842 |
| Hg38 Start | 97914560 |
| Hg38 End | 97914560 |
| Junction Sequence | AGAGGATAATTTGGAAGTAGTTCCCCAAAATTCTAAATATGCTTACCTTCTAACCCAATATATCCACTTCTGATATCCTGTTCATAAAAATACATAAGT |
| Target Gene ▶ | |
| Target Gene | TRMO |
| Nearby Gene | - |
| Distance | - |
| Virus Information ▶ | |
| Virus Name | Human Papillomavirus |
| Virus Subtype Name | HPV16 |
| Virus Genome Accession | NC_001526.4 |
| TaxonomyID | 10566 |
| Virus Abbreviation | HPV |
| Virus Genome | Human papillomavirus type 16, complete genome |
| Virus Genome Length | 7906 |
| Virus Breakpoint1 | 2099 |
| Virus Breakpoint2 | - |
| Virus Gene Name | E1 |
| Virus Region Type | - |
| Integrated Virus Sequence | CGCCTAGAATGTGCTATTTATTACAAGGCCAGAGAAATGGGATTTAAACATATTAACCACCAGGTGGTGCCAACACTGGCTGTATCAAAGAATAAAGCAT| |TACAAGCAATTGAACTGCAACTAACGTTAGAAACAATATATAACTCACAATATAGTAATGAAAAGTGGACATTACAAGACGTTAGCCTTGAAGTGTATTT |
| ViMIC ID | - |
Center for Precision Health
McWilliams School of Biomedical Informatics at UTHealth Houston
7000 Fannin Street, Suite 600, Houston, TX 77030
Email: Zhongming Zhao, Ph.D