Basic Information ▶ | |
VISDB ID | TVIS20003816 |
---|---|
Fusion Name | HPV-TRMO integration |
Validated | Yes |
Curated Way | VISDB1.0 |
Method | Amplification of Papillomavirus Oncogene Transcripts (APOT) |
Wet Assay | Yes |
Sample ID | UPCI:SCC152 |
Sample Name | UPCI:SCC152 |
Sample Type | Cell line |
Age | - |
Gender | - |
Disease Information ▶ | |
Disease Name | Head and neck squamous cell carcinoma |
Disease Abbreviation | HNSCC |
Cancer | Yes |
Literature ▶ | |
PubMed ID | 25082736 |
Journal | Int J Cancer |
Published Year | 2015 |
Human Genome ▶ | |
Human Genome Version Description | GRCh37.p5 |
Human Genome RefSeq Accession | GCF_000001405.17 |
Human Chromosome | chr9 |
Cytogenetic Band | q22.33 |
Human Strand | - |
Human Integration Location Type | Intron2 |
Hg19 Start | 100676842 |
Hg19 End | 100676842 |
Hg38 Start | 97914560 |
Hg38 End | 97914560 |
Junction Sequence | AGAGGATAATTTGGAAGTAGTTCCCCAAAATTCTAAATATGCTTACCTTCTAACCCAATATATCCACTTCTGATATCCTGTTCATAAAAATACATAAGT |
Target Gene ▶ | |
Target Gene | TRMO |
Nearby Gene | - |
Distance | - |
Virus Information ▶ | |
Virus Name | Human Papillomavirus |
Virus Subtype Name | HPV16 |
Virus Genome Accession | NC_001526.4 |
TaxonomyID | 10566 |
Virus Abbreviation | HPV |
Virus Genome | Human papillomavirus type 16, complete genome |
Virus Genome Length | 7906 |
Virus Breakpoint1 | 2099 |
Virus Breakpoint2 | - |
Virus Gene Name | E1 |
Virus Region Type | - |
Integrated Virus Sequence | CGCCTAGAATGTGCTATTTATTACAAGGCCAGAGAAATGGGATTTAAACATATTAACCACCAGGTGGTGCCAACACTGGCTGTATCAAAGAATAAAGCAT| |TACAAGCAATTGAACTGCAACTAACGTTAGAAACAATATATAACTCACAATATAGTAATGAAAAGTGGACATTACAAGACGTTAGCCTTGAAGTGTATTT |
ViMIC ID | - |