| Basic Information ▶ | |
| VISDB ID | TVIS20004154 |
|---|---|
| Fusion Name | HPV-chr2 integration |
| Validated | Yes |
| Curated Way | VISDB1.0 |
| Method | Amplification of Papillomavirus Oncogene Transcripts (APOT) |
| Wet Assay | Yes |
| Sample ID | 20861 |
| Sample Name | 20861 |
| Sample Type | Cell line |
| Age | - |
| Gender | - |
| Disease Information ▶ | |
| Disease Name | Cervical carcinoma |
| Disease Abbreviation | CC |
| Cancer | Yes |
| Literature ▶ | |
| PubMed ID | 29364907 |
| Journal | PLOS Genetics |
| Published Year | 2018 |
| Human Genome ▶ | |
| Human Genome Version Description | GRCh37/hg19 |
| Human Genome RefSeq Accession | GCF_000001405.13 |
| Human Chromosome | chr2 |
| Cytogenetic Band | p23.2 |
| Human Strand | - |
| Human Integration Location Type | Intergenic |
| Hg19 Start | 28595896 |
| Hg19 End | 28596474 |
| Hg38 Start | 28373029 |
| Hg38 End | 28373607 |
| Junction Sequence | attctaccaaataaatggcccaaacttttgaagactgtcaaggtcacaaaagacaaggagagattgaagatctgtttcctattcaaggaaactaatgaggcatgacaactcaacgcagctcagaaccctgacttggaacctggaccagaaaggcaaatgaggcatcattgggacagttggagaaatctggatggggtccatgggttggaggatggtgttaaattaattatgacttcctaatttggaggatttaat |
| Target Gene ▶ | |
| Target Gene | - |
| Nearby Gene | ENSG00000298043 |
| Distance | 6826 |
| Virus Information ▶ | |
| Virus Name | Human Papillomavirus |
| Virus Subtype Name | HPV16 |
| Virus Genome Accession | AF125673.1 |
| TaxonomyID | 10566 |
| Virus Abbreviation | HPV |
| Virus Genome | Human papillomavirus type 16 isolate 16W12E, complete genome |
| Virus Genome Length | 7904 |
| Virus Breakpoint1 | 3151 |
| Virus Breakpoint2 | 3435 |
| Virus Gene Name | E2/E4 |
| Virus Region Type | - |
| Integrated Virus Sequence | AACTGGACACATATATATATTTGTGAAGAAGCATCAGTAACTGTGGTAGAGGGTCAAGTTGACTATTATGGTTTATATTATGTTCATGAAGGAATACGAACATATTTTGTGCAGTTTAAAGATGATGCAGAAAAATATAGTAAAAATAAAGTATGGGAAGTTCATGCGGGTGGTCAGGTAATATTATGTCCTACATCTGTGTTTAGCAGCAACGAAGTATCCTCTCCTGAAATTATTAGGCAGCACTTGGCCAAC |
| ViMIC ID | - |
Center for Precision Health
McWilliams School of Biomedical Informatics at UTHealth Houston
7000 Fannin Street, Suite 600, Houston, TX 77030
Email: Zhongming Zhao, Ph.D