| Basic Information ▶ | |
| VISDB ID | TVIS20004180 |
|---|---|
| Fusion Name | HPV-LINC00486 integration |
| Validated | Yes |
| Curated Way | VISDB1.0 |
| Method | Amplification of Papillomavirus Oncogene Transcripts (APOT) |
| Wet Assay | Yes |
| Sample ID | 20863 |
| Sample Name | 20863 |
| Sample Type | Cell line |
| Age | - |
| Gender | - |
| Disease Information ▶ | |
| Disease Name | Cervical carcinoma |
| Disease Abbreviation | CC |
| Cancer | Yes |
| Literature ▶ | |
| PubMed ID | 29364907 |
| Journal | PLOS Genetics |
| Published Year | 2018 |
| Human Genome ▶ | |
| Human Genome Version Description | GRCh37/hg19 |
| Human Genome RefSeq Accession | GCF_000001405.13 |
| Human Chromosome | chr2 |
| Cytogenetic Band | p22.3 |
| Human Strand | - |
| Human Integration Location Type | Intronic |
| Hg19 Start | 33141430 |
| Hg19 End | 33141670 |
| Hg38 Start | 32916363 |
| Hg38 End | 32916603 |
| Junction Sequence | gggggggggggggggggggggggggggggggggggggagggggggggggggggggggggggggggggggggggggggagggggggggggggggggggggggggggggggaggggggggggggaggggggggggggggggggggggggggggggggggggggggggggggggggggggggggggggggggggggagggggggggggggggggggggggcgggggcggggggggggaggggg |
| Target Gene ▶ | |
| Target Gene | LINC00486, ENSG00000293668, ENSG00000294557 |
| Nearby Gene | - |
| Distance | - |
| Virus Information ▶ | |
| Virus Name | Human Papillomavirus |
| Virus Subtype Name | HPV16 |
| Virus Genome Accession | AF125673.1 |
| TaxonomyID | 10566 |
| Virus Abbreviation | HPV |
| Virus Genome | Human papillomavirus type 16 isolate 16W12E, complete genome |
| Virus Genome Length | 7904 |
| Virus Breakpoint1 | 230 |
| Virus Breakpoint2 | 815 |
| Virus Gene Name | E6/E7 |
| Virus Region Type | - |
| Integrated Virus Sequence | ATGACTTTGCTTTTCGGGATTTATGTATAGTATATAGAGATGGGAATCCATATGCTGTATGTGATAAATGTTTAAAGTTTTATTCTAAAATTAGTGAGTATAGACATTATTGTTATAGTGTGTATGGAACAACATTAGAACAGCAATACAACAAACCGTTGTGTGATTTGTTAATTAGGTGTATTAACTGTCAAAAGCCACTGTGTCCTGAAGAAAAGCAAAGACATCTGGACAAAAAGCAAAGATTCCATAATA |
| ViMIC ID | - |
Center for Precision Health
McWilliams School of Biomedical Informatics at UTHealth Houston
7000 Fannin Street, Suite 600, Houston, TX 77030
Email: Zhongming Zhao, Ph.D