| Basic Information ▶ | |
| VISDB ID | TVIS20004240 |
|---|---|
| Fusion Name | HPV-LOC100506023 integration |
| Validated | Yes |
| Curated Way | VISDB1.0 |
| Method | Whole genome, RNA, Whole-Exome sequencing and PCR |
| Wet Assay | Yes |
| Sample ID | TCGA-CR-6473 |
| Sample Name | TCGA-CR-6473 |
| Sample Type | Tumor |
| Age | 68 |
| Gender | - |
| Disease Information ▶ | |
| Disease Name | Head and neck squamous cell carcinoma |
| Disease Abbreviation | HNSCC |
| Cancer | Yes |
| Literature ▶ | |
| PubMed ID | 25313082 |
| Journal | Proc Natl Acad Sci U S A |
| Published Year | 2014 |
| Human Genome ▶ | |
| Human Genome Version Description | GRCh37/hg19 |
| Human Genome RefSeq Accession | GCF_000001405.13 |
| Human Chromosome | chr1 |
| Cytogenetic Band | q25.1 |
| Human Strand | |
| Human Integration Location Type | Intronic |
| Hg19 Start | 173239973 |
| Hg19 End | 173239973 |
| Hg38 Start | 173270834 |
| Hg38 End | 173270834 |
| Junction Sequence | - |
| Target Gene ▶ | |
| Target Gene | TNFSF4 |
| Nearby Gene | - |
| Distance | - |
| Virus Information ▶ | |
| Virus Name | Human Papillomavirus |
| Virus Subtype Name | HPV16 |
| Virus Genome Accession | AY686584 |
| TaxonomyID | 10566 |
| Virus Abbreviation | HPV |
| Virus Genome | Human papillomavirus type 16 isolate Qv17722E, complete genome |
| Virus Genome Length | 7906 |
| Virus Breakpoint1 | 2143 |
| Virus Breakpoint2 | - |
| Virus Gene Name | E1 |
| Virus Region Type | - |
| Integrated Virus Sequence | AAAAGTAATTCACAGGCAAAAATTGTAAAGGATTGTGCAACAATGTGTAGACATTATAAACGAGCAGAAAAAAAACAAATGAGTATGAGTCAATGGATAA| |AATATAGATGTGATAGGGTAGATGATGGAGGTGATTGGAAGCAAATTGTTATGTTTTTAAGGTATCAAGGTGTAGAGTTTATGTCATTTTTAACTGCATT |
| ViMIC ID | - |