Basic Information ▶ | |
VISDB ID | TVIS20004269 |
---|---|
Fusion Name | HPV-ETS2 integration |
Validated | Yes |
Curated Way | VISDB1.0 |
Method | Whole genome, RNA, Whole-Exome sequencing and PCR |
Wet Assay | Yes |
Sample ID | TCGA-CV-6961 |
Sample Name | TCGA-CV-6961 |
Sample Type | Tumor |
Age | 61 |
Gender | - |
Disease Information ▶ | |
Disease Name | Head and neck squamous cell carcinoma |
Disease Abbreviation | HNSCC |
Cancer | Yes |
Literature ▶ | |
PubMed ID | 25313082 |
Journal | Proc Natl Acad Sci U S A |
Published Year | 2014 |
Human Genome ▶ | |
Human Genome Version Description | GRCh37/hg19 |
Human Genome RefSeq Accession | GCF_000001405.13 |
Human Chromosome | chr21 |
Cytogenetic Band | q22.2 |
Human Strand | |
Human Integration Location Type | Intronic |
Hg19 Start | 40187057 |
Hg19 End | 40187057 |
Hg38 Start | 38815133 |
Hg38 End | 38815133 |
Junction Sequence | - |
Target Gene ▶ | |
Target Gene | ETS2, ETS2-AS1 |
Nearby Gene | - |
Distance | - |
Virus Information ▶ | |
Virus Name | Human Papillomavirus |
Virus Subtype Name | HPV16 |
Virus Genome Accession | AY686584 |
TaxonomyID | 10566 |
Virus Abbreviation | HPV |
Virus Genome | Human papillomavirus type 16 isolate Qv17722E, complete genome |
Virus Genome Length | 7906 |
Virus Breakpoint1 | 5572 |
Virus Breakpoint2 | - |
Virus Gene Name | L2-L1 |
Virus Region Type | - |
Integrated Virus Sequence | GGTCCTGATATACCCATTAATATAACTGACCAAGCTCCTTCATTAATTCCTATAGTTCCAGGGTCTCCACAATATACAATTATTGCTGATGCAGGTGACT| |TTTATTTACATCCTAGTTATTACATGTTACGAAAACGACGTAAACGTTTACCATATTTTTTTTCAGATGTCTCTTTGGCTGCCTAGTGAGGCCACTGTCT |
ViMIC ID | - |