| Basic Information ▶ | |
| VISDB ID | TVIS20004406 |
|---|---|
| Fusion Name | HPV-chr15:q25.1 integration |
| Validated | Yes |
| Curated Way | VISDB1.0 |
| Method | Detection of integrated papilloma sequences & PCR (DIPS-PCR) |
| Wet Assay | Yes |
| Sample ID | 9 |
| Sample Name | 9 |
| Sample Type | Tumor |
| Age | - |
| Gender | - |
| Disease Information ▶ | |
| Disease Name | Oropharyngeal squamous cell carcinoma |
| Disease Abbreviation | OPSCC |
| Cancer | Yes |
| Literature ▶ | |
| PubMed ID | 24586376 |
| Journal | PLoS One |
| Published Year | 2014 |
| Human Genome ▶ | |
| Human Genome Version Description | GRCh37.p5 |
| Human Genome RefSeq Accession | GCF_000001405.17 |
| Human Chromosome | chr15 |
| Cytogenetic Band | q25.1 |
| Human Strand | - |
| Human Integration Location Type | Intergenic |
| Hg19 Start | 80225117 |
| Hg19 End | 80225117 |
| Hg38 Start | 79932775 |
| Hg38 End | 79932775 |
| Junction Sequence | CCTGGATCTCTTGTTCGAAAGTTGGCTGTGTATTTGGGCAGTACTCCAGCTACTGGAGAGATAGGTAGGAAAGCCGGGAGACCCATCAGTCAGCAGTTT |
| Target Gene ▶ | |
| Target Gene | - |
| Nearby Gene | ST20-AS1 |
| Distance | 5471 |
| Virus Information ▶ | |
| Virus Name | Human Papillomavirus |
| Virus Subtype Name | HPV16 |
| Virus Genome Accession | NC_001526.1 |
| TaxonomyID | 10566 |
| Virus Abbreviation | HPV |
| Virus Genome | Human papillomavirus type 16, complete genome |
| Virus Genome Length | 7904 |
| Virus Breakpoint1 | 1538 |
| Virus Breakpoint2 | - |
| Virus Gene Name | E1 |
| Virus Region Type | - |
| Integrated Virus Sequence | AAATATTTTAAATGTACTAAAAACTAGTAATGCAAAGGCAGCAATGTTAGCAAAATTTAAAGAGTTATACGGGGTGAGTTTTTCAGAATTAGTAAGACCA| |TTTAAAAGTAATAAATCAACGTGTTGCGATTGGTGTATTGCTGCATTTGGACTTACACCCAGTATAGCTGACAGTATAAAAACACTATTACAACAATATT |
| ViMIC ID | - |
Center for Precision Health
McWilliams School of Biomedical Informatics at UTHealth Houston
7000 Fannin Street, Suite 600, Houston, TX 77030
Email: Zhongming Zhao, Ph.D