| Basic Information ▶ | |
| VISDB ID | TVIS20010605 |
|---|---|
| Fusion Name | HPV-chr4:49636060 integration |
| Validated | No |
| Curated Way | ViMIC |
| Method | Probe-capture and next-generation sequencing |
| Wet Assay | Yes |
| Sample ID | #NAME? |
| Sample Name | Not given |
| Sample Type | Tumor |
| Age | - |
| Gender | - |
| Disease Information ▶ | |
| Disease Name | Prostate cancer |
| Disease Abbreviation | PCa |
| Cancer | Yes |
| Literature ▶ | |
| PubMed ID | 30794288 |
| Journal | Carcinogenesis |
| Published Year | 2019 |
| Human Genome ▶ | |
| Human Genome Version Description | GRCh37/hg19 |
| Human Genome RefSeq Accession | GCF_000001405.13 |
| Human Chromosome | chr4 |
| Cytogenetic Band | p11 |
| Human Strand | |
| Human Integration Location Type | intergenic |
| Hg19 Start | 49638077 |
| Hg19 End | 49638078 |
| Hg38 Start | 49636060 |
| Hg38 End | 49636061 |
| Junction Sequence | - |
| Target Gene ▶ | |
| Target Gene | - |
| Nearby Gene | - |
| Distance | - |
| Virus Information ▶ | |
| Virus Name | Human Papillomavirus |
| Virus Subtype Name | HPV2 |
| Virus Genome Accession | - |
| TaxonomyID | 10566 |
| Virus Abbreviation | HPV |
| Virus Genome | - |
| Virus Genome Length | - |
| Virus Breakpoint1 | 3550 |
| Virus Breakpoint2 | - |
| Virus Gene Name | CDS of E2 gene |
| Virus Region Type | - |
| Integrated Virus Sequence | CGAACGGTCGGAGAGGGGGAAGTGGAGTGTTACAACAA |
| ViMIC ID | 5402760 |
| Predicted VIS Effect ▶ | |
| Predicted VIS Effect | - |