Basic Information ▶ | |
VISDB ID | TVIS20010644 |
---|---|
Fusion Name | HPV-ENSG00000250646 integration |
Validated | No |
Curated Way | ViMIC |
Method | Probe-capture and next-generation sequencing |
Wet Assay | Yes |
Sample ID | #NAME? |
Sample Name | Not given |
Sample Type | Tumor |
Age | - |
Gender | - |
Disease Information ▶ | |
Disease Name | Prostate cancer |
Disease Abbreviation | PCa |
Cancer | Yes |
Literature ▶ | |
PubMed ID | 30794288 |
Journal | Carcinogenesis |
Published Year | 2019 |
Human Genome ▶ | |
Human Genome Version Description | GRCh37/hg19 |
Human Genome RefSeq Accession | GCF_000001405.13 |
Human Chromosome | chr4 |
Cytogenetic Band | q12 |
Human Strand | |
Human Integration Location Type | intronic |
Hg19 Start | 55942443 |
Hg19 End | 55942444 |
Hg38 Start | 55076276 |
Hg38 End | 55076277 |
Junction Sequence | - |
Target Gene ▶ | |
Target Gene | ENSG00000250646 |
Nearby Gene | - |
Distance | - |
Virus Information ▶ | |
Virus Name | Human Papillomavirus |
Virus Subtype Name | HPV18 |
Virus Genome Accession | - |
TaxonomyID | 10566 |
Virus Abbreviation | HPV |
Virus Genome | - |
Virus Genome Length | - |
Virus Breakpoint1 | 5307 |
Virus Breakpoint2 | - |
Virus Gene Name | CDS of L2 gene |
Virus Region Type | - |
Integrated Virus Sequence | TTAGTATCTGCCACGGAAGGACAATGACTTGTTTGATATATATGCAGATGACAT |
ViMIC ID | 5402799 |