| Basic Information ▶ | |
| VISDB ID | TVIS20014872 |
|---|---|
| Fusion Name | HPV-PACSIN2 integration |
| Validated | Yes |
| Curated Way | Curated |
| Method | RNA sequencing, followed by integration sites detection using ChimeraScan, deFuse and SOAPFuse |
| Wet Assay | Yes |
| Sample ID | RC87 |
| Sample Name | ZJU |
| Sample Type | Tumor |
| Age | 45 |
| Gender | Female |
| Disease Information ▶ | |
| Disease Name | Cervical Cancer |
| Disease Abbreviation | CC |
| Cancer | Yes |
| Literature ▶ | |
| PubMed ID | 33785400 |
| Journal | Genomics |
| Published Year | 2021 |
| Human Genome ▶ | |
| Human Genome Version Description | GRCh37/hg19 |
| Human Genome RefSeq Accession | GCF_000001405.13 |
| Human Chromosome | chr22 |
| Cytogenetic Band | q13.2 |
| Human Strand | |
| Human Integration Location Type | intronic |
| Hg19 Start | 43325489 |
| Hg19 End | 43325489 |
| Hg38 Start | 42929483 |
| Hg38 End | 42929483 |
| Junction Sequence | TCATTCTGGAGCAGACGTCACACAATTGGAAAGATGTCCCCAGCTGTGTGATTAGTATGACATCCATTCTAAAAGGTGAACAAAAGAACCTGGAAAGAAACCAGACAGGATCGTTTTGGAGTTCTGAGATACTCATTCTTTTGCCTGTACTTTGGAAGCAGGATCAAGCCATTCGTAGGCACGCCACTCCCACTGAACATTTCA|AACGCTTTATGCTTTACATCTATTGAAATATCATTTCCATCAAGTGCATTTCTTAAATAATCATCTATGTATGTCCAGCATATTGCTGTAACATCATCTATCATTCCTATTTTTGCATCTGACAATGGTTGTAGCCAAAAATGACTTTTGGCGTTTACATATGATATTACACATCCTTGTAAAAAGTGGATTAAACTCATTGCAAAATATGTTTTC |
| Target Gene ▶ | |
| Target Gene | PACSIN2 |
| Nearby Gene | - |
| Distance | - |
| Virus Information ▶ | |
| Virus Name | Human Papillomavirus |
| Virus Subtype Name | HPV67 |
| Virus Genome Accession | - |
| TaxonomyID | 10566 |
| Virus Abbreviation | HPV |
| Virus Genome | - |
| Virus Genome Length | - |
| Virus Breakpoint1 | 2490 |
| Virus Breakpoint2 | - |
| Virus Gene Name | - |
| Virus Region Type | - |
| Integrated Virus Sequence | - |
| ViMIC ID | - |
Center for Precision Health
McWilliams School of Biomedical Informatics at UTHealth Houston
7000 Fannin Street, Suite 600, Houston, TX 77030
Email: Zhongming Zhao, Ph.D