| Basic Information ▶ | |
| VISDB ID | TVIS20016787 |
|---|---|
| Fusion Name | HPV-chr18:43387425 integration |
| Validated | Yes |
| Curated Way | Curated |
| Method | Targeted Capture Sequencing, followed by integration sites detection by SearchHPV |
| Wet Assay | Yes |
| Sample ID | - |
| Sample Name | PDX-294R |
| Sample Type | Tumor derived xenograft |
| Age | - |
| Gender | - |
| Disease Information ▶ | |
| Disease Name | Head and Neck Squamous Cell Carcinoma (HNSCC), Cervical Cancer |
| Disease Abbreviation | HNSCC, CC |
| Cancer | Yes |
| Literature ▶ | |
| PubMed ID | 34160069 |
| Journal | Cancer |
| Published Year | 2021 |
| Human Genome ▶ | |
| Human Genome Version Description | GRCh37/hg19 |
| Human Genome RefSeq Accession | GCF_000001405.13 |
| Human Chromosome | chr18 |
| Cytogenetic Band | q12.3 |
| Human Strand | |
| Human Integration Location Type | intergenic |
| Hg19 Start | 40967390 |
| Hg19 End | 40967390 |
| Hg38 Start | 43387425 |
| Hg38 End | 43387425 |
| Junction Sequence | ACCTCTATTCTCAATATTTTCAGAAGGCAAAAAGTGAAACTTTAATAGTTTGTGTTTGTTTGTAATCCATAGATATACATTCTCTATTATCCACACCTGCATTTGCTGCATAAGCAGAATGCAGGTGTGGATAATAGAGAATGTATATCTATGGATTACAAACAAACACAAACTATTAAAGTTTCCTTTTTGCTTCTGAAAATATTTTGAGAAATTAGAGATAATAAGTTATGGAGCACTCCTCTATTGAAACCCCTCCTTGAGGAGAAAAGAAGACGACAACTTTGCGTTCGGCACAGTGAACAATGGCGCCTTGCCAGCAAGTTTCCTTTGAGCAGAGACATTTCTCTCC |
| Target Gene ▶ | |
| Target Gene | - |
| Nearby Gene | - |
| Distance | - |
| Virus Information ▶ | |
| Virus Name | Human Papillomavirus |
| Virus Subtype Name | HPV16 |
| Virus Genome Accession | HPV16REF |
| TaxonomyID | 10566 |
| Virus Abbreviation | HPV |
| Virus Genome | Human Papillomavirus 16 (HPV16), complete genome |
| Virus Genome Length | 7904 bp |
| Virus Breakpoint1 | 5671;5239 |
| Virus Breakpoint2 | - |
| Virus Gene Name | - |
| Virus Region Type | - |
| Integrated Virus Sequence | - |
| ViMIC ID | - |
Center for Precision Health
McWilliams School of Biomedical Informatics at UTHealth Houston
7000 Fannin Street, Suite 600, Houston, TX 77030
Email: Zhongming Zhao, Ph.D