Basic Information ▶ | |
VISDB ID | TVIS20021218 |
---|---|
Fusion Name | HPV-ENSG00000228033 integration |
Validated | No |
Curated Way | Curated |
Method | HPV capture sequencing |
Wet Assay | Yes |
Sample ID | 17O010290.1 |
Sample Name | New sample |
Sample Type | Tumor |
Age | - |
Gender | - |
Disease Information ▶ | |
Disease Name | Cervical cancer |
Disease Abbreviation | CC |
Cancer | Yes |
Literature ▶ | |
PubMed ID | 35968887 |
Journal | Clinical and Translational Medicine |
Published Year | 2022 |
Human Genome ▶ | |
Human Genome Version Description | GRCh38/hg38 |
Human Genome RefSeq Accession | GCF_000001405.40 |
Human Chromosome | chr2 |
Cytogenetic Band | p16.2 |
Human Strand | + |
Human Integration Location Type | intronic |
Hg19 Start | - |
Hg19 End | - |
Hg38 Start | 52866787 |
Hg38 End | 52866787 |
Junction Sequence | CAGAGATCCATGCATACTTCTCTTTGTTCTATGTTTGACACTGTAATAAGCAACAGCCATTGCTACACACCCTTTGTTAATTTCATCAAAATTTAAACAGGAGGAGGAGGTAGATAAACCTTGTTGTCACTAGGCCGCCACA |
Target Gene ▶ | |
Target Gene | ENSG00000228033 |
Nearby Gene | - |
Distance | - |
Virus Information ▶ | |
Virus Name | Human Papillomavirus |
Virus Subtype Name | HPV42 |
Virus Genome Accession | M73236 |
TaxonomyID | 10566 |
Virus Abbreviation | HPV |
Virus Genome | Human papillomavirus ORF E6, ORF E7, ORF E1, ORF E2, ORF E4, ORF E5, ORF L2, and ORF L1 genes, complete cds |
Virus Genome Length | 7,917 bp |
Virus Breakpoint1 | 5891 |
Virus Breakpoint2 | - |
Virus Gene Name | L1 |
Virus Region Type | - |
Integrated Virus Sequence | - |
ViMIC ID | - |