| Basic Information ▶ | |
| VISDB ID | TVIS20022709 |
|---|---|
| Fusion Name | HPV-ENSG00000307341 integration |
| Validated | No |
| Curated Way | Curated |
| Method | HPV capture sequencing |
| Wet Assay | Yes |
| Sample ID | G151224R26001.25 |
| Sample Name | New sample |
| Sample Type | Tumor |
| Age | - |
| Gender | - |
| Disease Information ▶ | |
| Disease Name | Cervical cancer |
| Disease Abbreviation | CC |
| Cancer | Yes |
| Literature ▶ | |
| PubMed ID | 35968887 |
| Journal | Clinical and Translational Medicine |
| Published Year | 2022 |
| Human Genome ▶ | |
| Human Genome Version Description | GRCh38/hg38 |
| Human Genome RefSeq Accession | GCF_000001405.40 |
| Human Chromosome | chrX |
| Cytogenetic Band | q25 |
| Human Strand | + |
| Human Integration Location Type | intronic |
| Hg19 Start | - |
| Hg19 End | - |
| Hg38 Start | 123507595 |
| Hg38 End | 123507595 |
| Junction Sequence | GGAGGCATCATGCTACCTGACTTCAAACTATACTACAAGGCTACAGTAACCAAAACAGCATGGTACTGGTACCAAAACAGAGATATAGAAACAATGAAACGCCAACACAACAATTGCAGGACTTGTTTAAAAGTAGCAATTTACAAGGT |
| Target Gene ▶ | |
| Target Gene | ENSG00000307341 |
| Nearby Gene | - |
| Distance | - |
| Virus Information ▶ | |
| Virus Name | Human Papillomavirus |
| Virus Subtype Name | HPV56 |
| Virus Genome Accession | X74483 |
| TaxonomyID | 10566 |
| Virus Abbreviation | HPV |
| Virus Genome | Human papillomavirus type 56 genomic DNA |
| Virus Genome Length | 7,844 bp |
| Virus Breakpoint1 | 1405 |
| Virus Breakpoint2 | - |
| Virus Gene Name | NA |
| Virus Region Type | - |
| Integrated Virus Sequence | - |
| ViMIC ID | - |
| Predicted VIS Effect ▶ | |
| Gene Id | ENSG00000307341.1 |
| Gene Name | ENSG00000307341 |
| Region | intron |
| Impact | intronic_insertion |
| Transcript | Transcript 1: ENST00000825206.1, Transcript 2: ENST00000825207.1, Transcript 3: ENST00000825209.1, Transcript 4: ENST00000825208.1, Transcript 5: ENST00000825210.1, Transcript 6: ENST00000825211.1, Transcript 7: ENST00000825212.1, Transcript 8: ENST00000825213.1, Transcript 9: ENST00000825214.1, Transcript 10: ENST00000825216.1, Transcript 11: ENST00000825215.1, Transcript 12: ENST00000825217.1, Transcript 13: ENST00000825218.1, Transcript 14: ENST00000825219.1, Transcript 15: ENST00000825220.1, Transcript 16: ENST00000825221.1, Transcript 17: ENST00000825222.1, Transcript 18: ENST00000825224.1, Transcript 19: ENST00000825223.1 |
| AlphaGenome Analysis | |
| Window | chrX:123442059-123573131 |
| RNA-seq Change (±2kb) | Mean: 2.99173789244378e-05 | Peak: 0.0121002197265625 |
| ATAC Change (±2kb) | Mean: -0.0005152180674485862 | Peak: 0.7341585159301758 |
| Interpretation | RNA-seq: no signal in region (REF≈0, ALT≈0) | Splice sites: no signal in region (REF≈0, ALT≈0) | ATAC: no signal in region (REF≈0, ALT≈0) |
| Visualization | |
Center for Precision Health
McWilliams School of Biomedical Informatics at UTHealth Houston
7000 Fannin Street, Suite 600, Houston, TX 77030
Email: Zhongming Zhao, Ph.D