| Basic Information ▶ | |
| VISDB ID | TVIS20022954 |
|---|---|
| Fusion Name | HPV-CDC42EP3 integration |
| Validated | No |
| Curated Way | Curated |
| Method | HPV capture sequencing |
| Wet Assay | Yes |
| Sample ID | G151224R38501.1 |
| Sample Name | New sample |
| Sample Type | Tumor |
| Age | - |
| Gender | - |
| Disease Information ▶ | |
| Disease Name | Cervical cancer |
| Disease Abbreviation | CC |
| Cancer | Yes |
| Literature ▶ | |
| PubMed ID | 35968887 |
| Journal | Clinical and Translational Medicine |
| Published Year | 2022 |
| Human Genome ▶ | |
| Human Genome Version Description | GRCh38/hg38 |
| Human Genome RefSeq Accession | GCF_000001405.40 |
| Human Chromosome | chr2 |
| Cytogenetic Band | p22.2 |
| Human Strand | + |
| Human Integration Location Type | intronic |
| Hg19 Start | - |
| Hg19 End | - |
| Hg38 Start | 37695709 |
| Hg38 End | 37695709 |
| Junction Sequence | AACTATAGAAGGATCAGAAGGGCCCACAGGATCTACTGTTAAAGGGGGTCTTACAGGAGCAAGTGTATCTGTAGCTGTGGAGGTCTCAGAGGATTTATTTTTGAGATGATATGGCTACAGAAGTGGGAGTTAGCAGTTGGGATGTGCAAAAAGGAAACAGCCTGAGATAGTGTTGTTGCTGCAAAAATAAATCCTCTGAGA |
| Target Gene ▶ | |
| Target Gene | CDC42EP3, CDC42EP3-AS1 |
| Nearby Gene | - |
| Distance | - |
| Virus Information ▶ | |
| Virus Name | Human Papillomavirus |
| Virus Subtype Name | HPV16 |
| Virus Genome Accession | K02718 |
| TaxonomyID | 10566 |
| Virus Abbreviation | HPV |
| Virus Genome | Human papillomavirus type 16 (HPV16), complete genome |
| Virus Genome Length | 7,904 bp |
| Virus Breakpoint1 | 4473 |
| Virus Breakpoint2 | - |
| Virus Gene Name | L2 |
| Virus Region Type | - |
| Integrated Virus Sequence | - |
| ViMIC ID | - |
| Predicted VIS Effect ▶ | |
| Region | intron |
| Impact | intronic_insertion |
| Transcript | Transcript 1: ENST00000751610.1, Transcript 2: ENST00000751609.1, Transcript 3: ENST00000956783.1, Transcript 4: ENST00000956784.1, Transcript 5: ENST00000956787.1, Transcript 6: ENST00000956786.1, Transcript 7: ENST00000956785.1, Transcript 8: ENST00000956789.1, Transcript 9: ENST00000956788.1, Transcript 10: ENST00000956791.1, Transcript 11: ENST00000956790.1, Transcript 12: ENST00000453555.1 |
| Transcript 1 Gene Id | ENSG00000236213.5 |
| Transcript 1 Gene Name | CDC42EP3-AS1 |
| Transcript 2 Gene Id | ENSG00000236213.5 |
| Transcript 2 Gene Name | CDC42EP3-AS1 |
| Transcript 3 Gene Id | ENSG00000163171.9 |
| Transcript 3 Gene Name | CDC42EP3 |
| Transcript 4 Gene Id | ENSG00000163171.9 |
| Transcript 4 Gene Name | CDC42EP3 |
| Transcript 5 Gene Id | ENSG00000163171.9 |
| Transcript 5 Gene Name | CDC42EP3 |
| Transcript 6 Gene Id | ENSG00000163171.9 |
| Transcript 6 Gene Name | CDC42EP3 |
| Transcript 7 Gene Id | ENSG00000163171.9 |
| Transcript 7 Gene Name | CDC42EP3 |
| Transcript 8 Gene Id | ENSG00000163171.9 |
| Transcript 8 Gene Name | CDC42EP3 |
| Transcript 9 Gene Id | ENSG00000163171.9 |
| Transcript 9 Gene Name | CDC42EP3 |
| Transcript 10 Gene Id | ENSG00000163171.9 |
| Transcript 10 Gene Name | CDC42EP3 |
| Transcript 11 Gene Id | ENSG00000163171.9 |
| Transcript 11 Gene Name | CDC42EP3 |
| Transcript 12 Gene Id | ENSG00000163171.9 |
| Transcript 12 Gene Name | CDC42EP3 |
| AlphaGenome Analysis | |
| Window | chr2:37630173-37761245 |
| RNA-seq Change (±2kb) | Mean: 2.0018076440919685e-07 | Peak: 0.00604248046875 |
| ATAC Change (±2kb) | Mean: 0.0006455967086367309 | Peak: 0.952880859375 |
| Interpretation | RNA-seq: no signal in region (REF≈0, ALT≈0) | Splice sites: no signal in region (REF≈0, ALT≈0) | ATAC: minimal change 3.3% |
| Visualization | |
Center for Precision Health
McWilliams School of Biomedical Informatics at UTHealth Houston
7000 Fannin Street, Suite 600, Houston, TX 77030
Email: Zhongming Zhao, Ph.D