| Basic Information ▼ | |
| VISDB ID | TVIS20023450 |
|---|---|
| Fusion Name | HPV-LINC00486 integration |
| Validated | No |
| Curated Way | Curated |
| Method | HPV capture sequencing |
| Wet Assay | Yes |
| Sample ID | G160718R49401.1 |
| Sample Name | New sample |
| Sample Type | Tumor |
| Age | - |
| Gender | - |
| Disease Information ▼ | |
| Disease Name | Cervical cancer |
| Disease Abbreviation | CC |
| Cancer | Yes |
| Literature ▼ | |
| PubMed ID | 35968887 |
| Journal | Clinical and Translational Medicine |
| Published Year | 2022 |
| Human Genome ▼ | |
| Human Genome Version Description | GRCh38/hg38 |
| Human Genome RefSeq Accession | GCF_000001405.40 |
| Human Chromosome | chr2 |
| Cytogenetic Band | p22.3 |
| Human Strand | + |
| Human Integration Location Type | intronic |
| Hg19 Start | - |
| Hg19 End | - |
| Hg38 Start | 32921641 |
| Hg38 End | 32921641 |
| Junction Sequence | GCCACCAGGCTCAAGCAATTCTCATGCCTAAAACAACACAGTACACACACAAAACAATTACATAACAAACAATGGTTACCTTTTAACCTGTTTTTGACATACACAACACATACATGACACAGACAATTACGCAACAGACAATGGTTACC |
| Target Gene ▼ | |
| Target Gene | LINC00486, ENSG00000293668, ENSG00000294557 |
| Nearby Gene | - |
| Distance | - |
| Virus Information ▼ | |
| Virus Name | Human Papillomavirus |
| Virus Subtype Name | HPV52 |
| Virus Genome Accession | X74481 |
| TaxonomyID | 10566 |
| Virus Abbreviation | HPV |
| Virus Genome | Human papillomavirus type 52 genomic DNA |
| Virus Genome Length | 7,942 bp |
| Virus Breakpoint1 | 7268 |
| Virus Breakpoint2 | - |
| Virus Gene Name | NA |
| Virus Region Type | - |
| Integrated Virus Sequence | - |
| ViMIC ID | - |
Center for Precision Health
McWilliams School of Biomedical Informatics at UTHealth Houston
7000 Fannin Street, Suite 600, Houston, TX 77030
Email: Zhongming Zhao, Ph.D