| Basic Information ▶ | |
| VISDB ID | TVIS20024061 |
|---|---|
| Fusion Name | HPV-SH3GL3 integration |
| Validated | No |
| Curated Way | Curated |
| Method | HPV capture sequencing |
| Wet Assay | Yes |
| Sample ID | P2016120A.73 |
| Sample Name | New sample |
| Sample Type | Tumor |
| Age | - |
| Gender | - |
| Disease Information ▶ | |
| Disease Name | Cervical cancer |
| Disease Abbreviation | CC |
| Cancer | Yes |
| Literature ▶ | |
| PubMed ID | 35968887 |
| Journal | Clinical and Translational Medicine |
| Published Year | 2022 |
| Human Genome ▶ | |
| Human Genome Version Description | GRCh38/hg38 |
| Human Genome RefSeq Accession | GCF_000001405.40 |
| Human Chromosome | chr15 |
| Cytogenetic Band | q25.2 |
| Human Strand | + |
| Human Integration Location Type | intronic |
| Hg19 Start | - |
| Hg19 End | - |
| Hg38 Start | 83594521 |
| Hg38 End | 83594521 |
| Junction Sequence | TACTTTATATAATGAACATATATTTATATTAGCTAAAGTCCACACTTCATTCACATTTATTTAATAGGGCTGGTGCTGTTGGTGAAAATGTACCAGACGATTTATACATTAAAGGCTCTGGGTCTACTGCAAATTTAGCCAGTTCAAATT |
| Target Gene ▶ | |
| Target Gene | SH3GL3 |
| Nearby Gene | - |
| Distance | - |
| Virus Information ▶ | |
| Virus Name | Human Papillomavirus |
| Virus Subtype Name | HPV16 |
| Virus Genome Accession | K02718 |
| TaxonomyID | 10566 |
| Virus Abbreviation | HPV |
| Virus Genome | Human papillomavirus type 16 (HPV16), complete genome |
| Virus Genome Length | 7,904 bp |
| Virus Breakpoint1 | 6410 |
| Virus Breakpoint2 | - |
| Virus Gene Name | L1 |
| Virus Region Type | - |
| Integrated Virus Sequence | - |
| ViMIC ID | - |
| Predicted VIS Effect ▶ | |
| Gene Id | ENSG00000140600.18 |
| Gene Name | SH3GL3 |
| Region | intron |
| Impact | intronic_insertion |
| Transcript | Transcript 1: ENST00000427482.7, Transcript 2: ENST00000951042.1, Transcript 3: ENST00000563901.5, Transcript 4: ENST00000903482.1, Transcript 5: ENST00000324537.5 |
| SpliceAI Score | |
| Delta Scores | Acceptor Gain: 0.000 | Acceptor Loss: 0.080 | Donor Gain: 0.000 | Donor Loss: 0.000 |
| Delta Score Max | 0.080 |
| Delta Position at Max | 37 |
| Delta Score Flag | LOW |
| Gene | SH3GL3 |
| AlphaGenome Analysis | |
| Window | chr15:83528985-83660057 |
| RNA-seq Change (±2kb) | Mean: 5.599761152552674e-06 | Peak: 0.075897216796875 |
| ATAC Change (±2kb) | Mean: 0.00037842572783119977 | Peak: 4.968749523162842 |
| Interpretation | RNA-seq: no signal in region (REF≈0, ALT≈0) | Splice sites: no signal in region (REF≈0, ALT≈0) | ATAC: minimal change 2.0% |
| Visualization | |
Center for Precision Health
McWilliams School of Biomedical Informatics at UTHealth Houston
7000 Fannin Street, Suite 600, Houston, TX 77030
Email: Zhongming Zhao, Ph.D