| Basic Information ▶ | |
| VISDB ID | TVIS20025117 |
|---|---|
| Fusion Name | HPV-chr10:30527607 integration |
| Validated | No |
| Curated Way | Curated |
| Method | EBV capture sequencing, followed by Viral Integration Pathway Analysis (VIPA) pipeline |
| Wet Assay | No |
| Sample ID | SRR1611106.7 |
| Sample Name | SRA189003 |
| Sample Type | Tumor |
| Age | - |
| Gender | - |
| Disease Information ▶ | |
| Disease Name | Cervical cancer |
| Disease Abbreviation | CC |
| Cancer | Yes |
| Literature ▶ | |
| PubMed ID | 35968887 |
| Journal | Clinical and Translational Medicine |
| Published Year | 2022 |
| Human Genome ▶ | |
| Human Genome Version Description | GRCh38/hg38 |
| Human Genome RefSeq Accession | GCF_000001405.40 |
| Human Chromosome | chr10 |
| Cytogenetic Band | p11.23 |
| Human Strand | + |
| Human Integration Location Type | intergenic |
| Hg19 Start | - |
| Hg19 End | - |
| Hg38 Start | 30527607 |
| Hg38 End | 30527607 |
| Junction Sequence | CAAACGACGACGACCTGCAGACACCACAGACACCGCCCAGCCCCTTCCAAAGCTGTTCTACGCAGACCCCATCAACATGAAGATTTATTTTTGATGGAGT |
| Target Gene ▶ | |
| Target Gene | - |
| Nearby Gene | ENSG00000289898 |
| Distance | 1580 |
| Virus Information ▶ | |
| Virus Name | Human Papillomavirus |
| Virus Subtype Name | HPV33 |
| Virus Genome Accession | M12732 |
| TaxonomyID | 10566 |
| Virus Abbreviation | HPV |
| Virus Genome | Human papillomavirus type 33, complete genome |
| Virus Genome Length | 7909 bp |
| Virus Breakpoint1 | 3492 |
| Virus Breakpoint2 | - |
| Virus Gene Name | E2,E4 |
| Virus Region Type | - |
| Integrated Virus Sequence | - |
| ViMIC ID | - |
Center for Precision Health
McWilliams School of Biomedical Informatics at UTHealth Houston
7000 Fannin Street, Suite 600, Houston, TX 77030
Email: Zhongming Zhao, Ph.D