Virus Integration Site Database Data Release 2.0

Details for VISDB ID: TVIS20028242

Genomic Region Visualization (IGV)

Basic Information ▶
VISDB IDTVIS20028242
Fusion NameHPV-ZNFX1 integration
ValidatedNo
Curated WayCurated
MethodVirus capture sequencing
Wet AssayYes
Sample ID-
Sample NameMOCC-001T
Sample TypeTumor
Age51
GenderFemale
Disease Information ▶
Disease NameCervical cancer
Disease AbbreviationCC
CancerYes
Literature ▶
PubMed ID36777180
JournalCell Genomics
Published Year2023
Human Genome ▶
Human Genome Version DescriptionGRCh38/hg38
Human Genome RefSeq AccessionGCF_000001405.40
Human Chromosomechr20
Cytogenetic Bandq13.13
Human Strand-
Human Integration Location Typeintronic
Hg19 Start-
Hg19 End-
Hg38 Start49277391
Hg38 End49277391
Junction SequenceTTTTGTTTTATATATACTATATTTTGTAGCGCCAGcGGCCATTTTGTAGCTTCAACCGAATTCGGTTGCATGCTTTTTGGCACAAAATGTGTTTTTTTAAATAGTTCTATGTCAGCAACTATAGTTTAAACTTGTACGTTTCCTGCTTGCCATGCGTGCCAAATCCCTGTTTTCCTGACCTGCACTGCTTGCCAACCATTCCATTGTTTTTTACACTGCACTATGTGCAACTACTGAATCACTATGTACATTGTGTCATATAAAATAAATCACTATGC | GCACCCCCTGGTGCTCGCTACCACCCTCTCCCCAAGGCCCCCATAACCCCGCCACCTCACAGCCTTGGCGCTCCCTGACCCCATAACATTTCCATTAGGGACCGTGGGCTCCCTGGGTCAGGGATTCCCCAGGACCCTGGAGACTTCCCCCAAACCCAGCTCTGCCTCCGACCTCAGCCTCCTGCGTCCCACTCTGGTGATGACTAGCCCCTCTCATTCTG
Target Gene ▶
Target GeneZNFX1, ZFAS1
Nearby Gene-
Distance-
Virus Information ▶
Virus NameHuman Papillomavirus
Virus Subtype NameHPV16
Virus Genome Accession-
TaxonomyID10566
Virus AbbreviationHPV
Virus Genome-
Virus Genome Length-
Virus Breakpoint17673
Virus Breakpoint2-
Virus Gene Name-
Virus Region Type-
Integrated Virus Sequence-
ViMIC ID-
Predicted VIS Effect ▶
TranscriptTranscript 1: ENST00000371754.8, Transcript 2: ENST00000371752.5, Transcript 3: ENST00000396105.6, Transcript 4: ENST00000371744.5, Transcript 5: ENST00000836974.1, Transcript 6: ENST00000836975.1, Transcript 7: ENST00000836976.1, Transcript 8: ENST00000836977.1, Transcript 9: ENST00000836978.1, Transcript 10: ENST00000836979.1, Transcript 11: ENST00000836980.1, Transcript 12: ENST00000836981.1, Transcript 13: ENST00000450535.5, Transcript 14: ENST00000417721.6, Transcript 15: ENST00000441722.6, Transcript 16: ENST00000371743.8, Transcript 17: ENST00000836982.1, Transcript 18: ENST00000458653.6, Transcript 19: ENST00000836983.1, Transcript 20: ENST00000836984.1, Transcript 21: ENST00000667889.2, Transcript 22: ENST00000326677.10, Transcript 23: ENST00000836985.1, Transcript 24: ENST00000836986.1, Transcript 25: ENST00000428008.7, Transcript 26: ENST00000652916.2, Transcript 27: ENST00000836987.1, Transcript 28: ENST00000663883.2, Transcript 29: ENST00000836988.1, Transcript 30: ENST00000836971.1, Transcript 31: ENST00000836989.1, Transcript 32: ENST00000836990.1, Transcript 33: ENST00000836991.1, Transcript 34: ENST00000836992.1, Transcript 35: ENST00000836993.1, Transcript 36: ENST00000836994.1, Transcript 37: ENST00000836972.1, Transcript 38: ENST00000836973.1, Transcript 39: ENST00000620594.3, Transcript 40: ENST00000837001.1, Transcript 41: ENST00000836995.1, Transcript 42: ENST00000836996.1, Transcript 43: ENST00000836997.1, Transcript 44: ENST00000836998.1, Transcript 45: ENST00000836970.1, Transcript 46: ENST00000837002.1, Transcript 47: ENST00000836999.1, Transcript 48: ENST00000623640.1, Transcript 49: ENST00000615787.1, Transcript 50: ENST00000386307.1, Transcript 51: ENST00000610973.1
Transcript 1 Gene IdENSG00000124201.15
Transcript 1 Gene NameZNFX1
Transcript 1 Regionintron
Transcript 1 Impactintronic_insertion
Transcript 2 Gene IdENSG00000124201.15
Transcript 2 Gene NameZNFX1
Transcript 2 Regionintron
Transcript 2 Impactintronic_insertion
Transcript 3 Gene IdENSG00000124201.15
Transcript 3 Gene NameZNFX1
Transcript 3 Regionintron
Transcript 3 Impactintronic_insertion
Transcript 4 Gene IdENSG00000124201.15
Transcript 4 Gene NameZNFX1
Transcript 4 Regionintron
Transcript 4 Impactintronic_insertion
Transcript 5 Gene IdENSG00000177410.14
Transcript 5 Gene NameZFAS1
Transcript 5 Regionintron
Transcript 5 Impactintronic_insertion
Transcript 6 Gene IdENSG00000177410.14
Transcript 6 Gene NameZFAS1
Transcript 6 Regionintron
Transcript 6 Impactintronic_insertion
Transcript 7 Gene IdENSG00000177410.14
Transcript 7 Gene NameZFAS1
Transcript 7 Regionpromoter
Transcript 7 Impactpromoter_insertion
Transcript 8 Gene IdENSG00000177410.14
Transcript 8 Gene NameZFAS1
Transcript 8 Regionpromoter
Transcript 8 Impactpromoter_insertion
Transcript 9 Gene IdENSG00000177410.14
Transcript 9 Gene NameZFAS1
Transcript 9 Regionpromoter
Transcript 9 Impactpromoter_insertion
Transcript 10 Gene IdENSG00000177410.14
Transcript 10 Gene NameZFAS1
Transcript 10 Regionpromoter
Transcript 10 Impactpromoter_insertion
Transcript 11 Gene IdENSG00000177410.14
Transcript 11 Gene NameZFAS1
Transcript 11 Regionpromoter
Transcript 11 Impactpromoter_insertion
Transcript 12 Gene IdENSG00000177410.14
Transcript 12 Gene NameZFAS1
Transcript 12 Regionpromoter
Transcript 12 Impactpromoter_insertion
Transcript 13 Gene IdENSG00000177410.14
Transcript 13 Gene NameZFAS1
Transcript 13 Regionpromoter
Transcript 13 Impactpromoter_insertion
Transcript 14 Gene IdENSG00000177410.14
Transcript 14 Gene NameZFAS1
Transcript 14 Regionpromoter
Transcript 14 Impactpromoter_insertion
Transcript 15 Gene IdENSG00000177410.14
Transcript 15 Gene NameZFAS1
Transcript 15 Regionpromoter
Transcript 15 Impactpromoter_insertion
Transcript 16 Gene IdENSG00000177410.14
Transcript 16 Gene NameZFAS1
Transcript 16 Regionpromoter
Transcript 16 Impactpromoter_insertion
Transcript 17 Gene IdENSG00000177410.14
Transcript 17 Gene NameZFAS1
Transcript 17 Regionpromoter
Transcript 17 Impactpromoter_insertion
Transcript 18 Gene IdENSG00000177410.14
Transcript 18 Gene NameZFAS1
Transcript 18 Regionpromoter
Transcript 18 Impactpromoter_insertion
Transcript 19 Gene IdENSG00000177410.14
Transcript 19 Gene NameZFAS1
Transcript 19 Regionpromoter
Transcript 19 Impactpromoter_insertion
Transcript 20 Gene IdENSG00000177410.14
Transcript 20 Gene NameZFAS1
Transcript 20 Regionpromoter
Transcript 20 Impactpromoter_insertion
Transcript 21 Gene IdENSG00000177410.14
Transcript 21 Gene NameZFAS1
Transcript 21 Regionpromoter
Transcript 21 Impactpromoter_insertion
Transcript 22 Gene IdENSG00000177410.14
Transcript 22 Gene NameZFAS1
Transcript 22 Regionpromoter
Transcript 22 Impactpromoter_insertion
Transcript 23 Gene IdENSG00000177410.14
Transcript 23 Gene NameZFAS1
Transcript 23 Regionpromoter
Transcript 23 Impactpromoter_insertion
Transcript 24 Gene IdENSG00000177410.14
Transcript 24 Gene NameZFAS1
Transcript 24 Regionpromoter
Transcript 24 Impactpromoter_insertion
Transcript 25 Gene IdENSG00000177410.14
Transcript 25 Gene NameZFAS1
Transcript 25 Regionpromoter
Transcript 25 Impactpromoter_insertion
Transcript 26 Gene IdENSG00000177410.14
Transcript 26 Gene NameZFAS1
Transcript 26 Regionpromoter
Transcript 26 Impactpromoter_insertion
Transcript 27 Gene IdENSG00000177410.14
Transcript 27 Gene NameZFAS1
Transcript 27 Regionpromoter
Transcript 27 Impactpromoter_insertion
Transcript 28 Gene IdENSG00000177410.14
Transcript 28 Gene NameZFAS1
Transcript 28 Regionpromoter
Transcript 28 Impactpromoter_insertion
Transcript 29 Gene IdENSG00000177410.14
Transcript 29 Gene NameZFAS1
Transcript 29 Regionpromoter
Transcript 29 Impactpromoter_insertion
Transcript 30 Gene IdENSG00000177410.14
Transcript 30 Gene NameZFAS1
Transcript 30 Regionpromoter
Transcript 30 Impactpromoter_insertion
Transcript 31 Gene IdENSG00000177410.14
Transcript 31 Gene NameZFAS1
Transcript 31 Regionpromoter
Transcript 31 Impactpromoter_insertion
Transcript 32 Gene IdENSG00000177410.14
Transcript 32 Gene NameZFAS1
Transcript 32 Regionpromoter
Transcript 32 Impactpromoter_insertion
Transcript 33 Gene IdENSG00000177410.14
Transcript 33 Gene NameZFAS1
Transcript 33 Regionpromoter
Transcript 33 Impactpromoter_insertion
Transcript 34 Gene IdENSG00000177410.14
Transcript 34 Gene NameZFAS1
Transcript 34 Regionpromoter
Transcript 34 Impactpromoter_insertion
Transcript 35 Gene IdENSG00000177410.14
Transcript 35 Gene NameZFAS1
Transcript 35 Regionpromoter
Transcript 35 Impactpromoter_insertion
Transcript 36 Gene IdENSG00000177410.14
Transcript 36 Gene NameZFAS1
Transcript 36 Regionpromoter
Transcript 36 Impactpromoter_insertion
Transcript 37 Gene IdENSG00000177410.14
Transcript 37 Gene NameZFAS1
Transcript 37 Regionpromoter
Transcript 37 Impactpromoter_insertion
Transcript 38 Gene IdENSG00000177410.14
Transcript 38 Gene NameZFAS1
Transcript 38 Regionpromoter
Transcript 38 Impactpromoter_insertion
Transcript 39 Gene IdENSG00000177410.14
Transcript 39 Gene NameZFAS1
Transcript 39 Regionpromoter
Transcript 39 Impactpromoter_insertion
Transcript 40 Gene IdENSG00000177410.14
Transcript 40 Gene NameZFAS1
Transcript 40 Regionpromoter
Transcript 40 Impactpromoter_insertion
Transcript 41 Gene IdENSG00000177410.14
Transcript 41 Gene NameZFAS1
Transcript 41 Regionpromoter
Transcript 41 Impactpromoter_insertion
Transcript 42 Gene IdENSG00000177410.14
Transcript 42 Gene NameZFAS1
Transcript 42 Regionpromoter
Transcript 42 Impactpromoter_insertion
Transcript 43 Gene IdENSG00000177410.14
Transcript 43 Gene NameZFAS1
Transcript 43 Regionpromoter
Transcript 43 Impactpromoter_insertion
Transcript 44 Gene IdENSG00000177410.14
Transcript 44 Gene NameZFAS1
Transcript 44 Regionpromoter
Transcript 44 Impactpromoter_insertion
Transcript 45 Gene IdENSG00000177410.14
Transcript 45 Gene NameZFAS1
Transcript 45 Regionpromoter
Transcript 45 Impactpromoter_insertion
Transcript 46 Gene IdENSG00000177410.14
Transcript 46 Gene NameZFAS1
Transcript 46 Regionpromoter
Transcript 46 Impactpromoter_insertion
Transcript 47 Gene IdENSG00000177410.14
Transcript 47 Gene NameZFAS1
Transcript 47 Regionpromoter
Transcript 47 Impactpromoter_insertion
Transcript 48 Gene IdENSG00000177410.14
Transcript 48 Gene NameZFAS1
Transcript 48 Regionpromoter
Transcript 48 Impactpromoter_insertion
Transcript 49 Gene IdENSG00000277830.1
Transcript 49 Gene NameENSG00000277830
Transcript 49 Regionpromoter
Transcript 49 Impactpromoter_insertion
Transcript 50 Gene IdENSG00000209042.1
Transcript 50 Gene NameSNORD12C
Transcript 50 Regionpromoter
Transcript 50 Impactpromoter_insertion
Transcript 51 Gene IdENSG00000274760.1
Transcript 51 Gene NameENSG00000274760
Transcript 51 Regionpromoter
Transcript 51 Impactpromoter_insertion
AlphaGenome Analysis
Chromosomechr20
Related Links: VISDB1.0  |  UCSC  |  NCBI  |  Ensembl  |  OncoKB  |  ONGene  |  HumCFS  |  COSMIC  |  miRTarBase  |  NPInter  |  ATACdb  |  ENCODE  |  Cytoscape
UTHealth Logo

Center for Precision Health

McWilliams School of Biomedical Informatics at UTHealth Houston

7000 Fannin Street, Suite 600, Houston, TX 77030

Email: Zhongming Zhao, Ph.D

Copyright © 2025   Bioinformatics and Systems Medicine Lab.   All Rights Reserved.
Site Policies  |   Emergency Information  |   Campus Carry  |   CPH