Basic Information ▶ | |
VISDB ID | TVIS20030997 |
---|---|
Fusion Name | HPV-chr2:83830426 integration |
Validated | Yes |
Curated Way | Curated |
Method | High-throughput Viral Integration Detection method |
Wet Assay | Yes |
Sample ID | - |
Sample Name | YKD2023 |
Sample Type | Tumor |
Age | 53.0 11.4 years |
Gender | Female |
Disease Information ▶ | |
Disease Name | Vaginal intraepithelial neoplasia |
Disease Abbreviation | VaIN |
Cancer | Yes |
Literature ▶ | |
PubMed ID | 38072997 |
Journal | Journal of Obstetrics and Gynaecology Research |
Published Year | 2023 |
Human Genome ▶ | |
Human Genome Version Description | GRCh37/hg19 |
Human Genome RefSeq Accession | GCF_000001405.13 |
Human Chromosome | chr2 |
Cytogenetic Band | p11.2 |
Human Strand | |
Human Integration Location Type | intergenic |
Hg19 Start | 84057550 |
Hg19 End | 84057550 |
Hg38 Start | 83830426 |
Hg38 End | 83830426 |
Junction Sequence | CTTTAGCATTTTGGACCCTCCCGTTGCTCCTATGCAAGTATATCCTTAGTAGTCCAGTCTGAAAAAGCATCAGAGAAGAACTCTGCTTGGCCAACCTCAATTCATATGCACCCTTTACATAAATAAAGTTGAGATAAGGAAGTAGAATTATGTAG_TCAAAAGTCATTACAACGGATGCCTATGTAAAACGCACCACTATATTTTATCATGCTGGAAGCTCTCGCTTGCTTACCGTGGGACATCCTTATTACCCCATTTCTAAATCTGGTAAAACAGACATCCCTAAGG |
Target Gene ▶ | |
Target Gene | - |
Nearby Gene | - |
Distance | - |
Virus Information ▶ | |
Virus Name | Human Papillomavirus |
Virus Subtype Name | HPV16/18 |
Virus Genome Accession | - |
TaxonomyID | 10566 |
Virus Abbreviation | HPV |
Virus Genome | - |
Virus Genome Length | - |
Virus Breakpoint1 | - |
Virus Breakpoint2 | - |
Virus Gene Name | - |
Virus Region Type | - |
Integrated Virus Sequence | - |
ViMIC ID | - |