| Basic Information ▶ | |
| VISDB ID | TVIS20031073 | 
|---|---|
| Fusion Name | HPV-chr10:125169994 integration | 
| Validated | Yes | 
| Curated Way | Curated | 
| Method | High-throughput Viral Integration Detection method | 
| Wet Assay | Yes | 
| Sample ID | - | 
| Sample Name | YKD2638 | 
| Sample Type | Tumor | 
| Age | 53.0 11.4 years | 
| Gender | Female | 
| Disease Information ▶ | |
| Disease Name | Vaginal intraepithelial neoplasia | 
| Disease Abbreviation | VaIN | 
| Cancer | Yes | 
| Literature ▶ | |
| PubMed ID | 38072997 | 
| Journal | Journal of Obstetrics and Gynaecology Research | 
| Published Year | 2023 | 
| Human Genome ▶ | |
| Human Genome Version Description | GRCh37/hg19 | 
| Human Genome RefSeq Accession | GCF_000001405.13 | 
| Human Chromosome | chr10 | 
| Cytogenetic Band | q26.13 | 
| Human Strand | |
| Human Integration Location Type | intergenic | 
| Hg19 Start | 42596896 | 
| Hg19 End | 42596896 | 
| Hg38 Start | 125169994 | 
| Hg38 End | 125169994 | 
| Junction Sequence | TAGTGAATGGCAACGTGACCAATTTTTGTCTCAAGTTAAAATACCAAAAACTATTACAGTGTCTACTGGATTTATGTCTATATGACAAATCTTGATACTGCATCCACAACATTACTGGC_TGGAATCATCTTCAAATGGAATGGAATGGAATCATCGCATAGAATCGAATGGAATTATCATCGAATGGAATCGAATGGAATCAACATCAAACGGAAAAAAACGGAATAATCGAATGGAATCGAAGAGAATCATCGAACGGACCCGAATGGAATCATCTAAAGGAATGG | 
| Target Gene ▶ | |
| Target Gene | - | 
| Nearby Gene | MRPS21P6 | 
| Distance | 3057 | 
| Virus Information ▶ | |
| Virus Name | Human Papillomavirus | 
| Virus Subtype Name | HPV16/18 | 
| Virus Genome Accession | - | 
| TaxonomyID | 10566 | 
| Virus Abbreviation | HPV | 
| Virus Genome | - | 
| Virus Genome Length | - | 
| Virus Breakpoint1 | - | 
| Virus Breakpoint2 | - | 
| Virus Gene Name | - | 
| Virus Region Type | - | 
| Integrated Virus Sequence | - | 
| ViMIC ID | - |