| Basic Information ▶ | |
| VISDB ID | TVIS20032075 |
|---|---|
| Fusion Name | HPV-SYTL4 integration |
| Validated | No |
| Curated Way | Curated |
| Method | High-throughput Viral Integration Detection method |
| Wet Assay | Yes |
| Sample ID | - |
| Sample Name | S106 |
| Sample Type | Tumor |
| Age | 57 = 59; >57 = 50 |
| Gender | - |
| Disease Information ▶ | |
| Disease Name | Oropharyngeal squamous cell carcinoma |
| Disease Abbreviation | OPSCC |
| Cancer | Yes |
| Literature ▶ | |
| PubMed ID | 38279874 |
| Journal | Clinical and Translational Medicine |
| Published Year | 2024 |
| Human Genome ▶ | |
| Human Genome Version Description | GRCh37/hg19 |
| Human Genome RefSeq Accession | GCF_000001405.13 |
| Human Chromosome | chrX |
| Cytogenetic Band | q22.1 |
| Human Strand | + |
| Human Integration Location Type | intronic |
| Hg19 Start | 99975261 |
| Hg19 End | 99975261 |
| Hg38 Start | 100720281 |
| Hg38 End | 100720281 |
| Junction Sequence | AATTTGCTTCCAATCACCTCCATCATCTACCCTATCACATCTATATTTTATCCATTGACTCATACTCATTTGTTTTTTTTACTTCACCCTTTCTTGTTCCTATCCAGTATTAGGTATCATCTTTGCATCATTTGTGTTGGA |
| Target Gene ▶ | |
| Target Gene | SYTL4 |
| Nearby Gene | - |
| Distance | - |
| Virus Information ▶ | |
| Virus Name | Human Papillomavirus |
| Virus Subtype Name | HPV16 |
| Virus Genome Accession | AF125673 |
| TaxonomyID | 10566 |
| Virus Abbreviation | HPV |
| Virus Genome | Human papillomavirus type 16 isolate 16W12E, complete genome |
| Virus Genome Length | 7904 bp |
| Virus Breakpoint1 | 2110 |
| Virus Breakpoint2 | - |
| Virus Gene Name | HpV16gp3_E1 |
| Virus Region Type | - |
| Integrated Virus Sequence | - |
| ViMIC ID | - |
| Predicted VIS Effect ▶ | |
| Gene Id | ENSG00000102362.17 |
| Gene Name | SYTL4 |
| Region | intron |
| Impact | intronic_insertion |
| Transcript | Transcript 1: ENST00000685623.1, Transcript 2: ENST00000877173.1, Transcript 3: ENST00000877177.1, Transcript 4: ENST00000877185.1, Transcript 5: ENST00000877183.1, Transcript 6: ENST00000877184.1, Transcript 7: ENST00000877181.1, Transcript 8: ENST00000877182.1, Transcript 9: ENST00000372989.6, Transcript 10: ENST00000877178.1, Transcript 11: ENST00000877179.1, Transcript 12: ENST00000877175.1, Transcript 13: ENST00000877176.1, Transcript 14: ENST00000877174.1, Transcript 15: ENST00000942513.1, Transcript 16: ENST00000877180.1, Transcript 17: ENST00000276141.10, Transcript 18: ENST00000942514.1, Transcript 19: ENST00000942511.1, Transcript 20: ENST00000942508.1, Transcript 21: ENST00000942509.1, Transcript 22: ENST00000942507.1, Transcript 23: ENST00000942512.1, Transcript 24: ENST00000942510.1, Transcript 25: ENST00000263033.9, Transcript 26: ENST00000372981.1 |
| SpliceAI Score | |
| Delta Scores | Acceptor Gain: 0.000 | Acceptor Loss: 0.000 | Donor Gain: 0.000 | Donor Loss: 0.000 |
| Delta Score Max | 0.000 |
| Delta Position at Max | -1156 |
| Delta Score Flag | LOW |
| Gene | SYTL4 |
| AlphaGenome Analysis | |
| Window | chrX:100654745-100785817 |
| RNA-seq Change (±2kb) | Mean: 0.00019265961600467563 | Peak: 0.083251953125 |
| ATAC Change (±2kb) | Mean: 0.00011787847324740142 | Peak: 5.812492847442627 |
| Interpretation | RNA-seq: no signal in region (REF≈0, ALT≈0) | Splice sites: no signal in region (REF≈0, ALT≈0) | ATAC: minimal change 0.6% |
| Visualization | |
Center for Precision Health
McWilliams School of Biomedical Informatics at UTHealth Houston
7000 Fannin Street, Suite 600, Houston, TX 77030
Email: Zhongming Zhao, Ph.D