| Basic Information ▶ | |
| VISDB ID | TVIS20033617 |
|---|---|
| Fusion Name | HPV-LINC01266 integration |
| Validated | No |
| Curated Way | Curated |
| Method | High-throughput Viral Integration Detection method |
| Wet Assay | Yes |
| Sample ID | - |
| Sample Name | S025 |
| Sample Type | Tumor |
| Age | 57 = 59; >57 = 50 |
| Gender | - |
| Disease Information ▶ | |
| Disease Name | Oropharyngeal squamous cell carcinoma |
| Disease Abbreviation | OPSCC |
| Cancer | Yes |
| Literature ▶ | |
| PubMed ID | 38279874 |
| Journal | Clinical and Translational Medicine |
| Published Year | 2024 |
| Human Genome ▶ | |
| Human Genome Version Description | GRCh37/hg19 |
| Human Genome RefSeq Accession | GCF_000001405.13 |
| Human Chromosome | chr3 |
| Cytogenetic Band | p26.3 |
| Human Strand | - |
| Human Integration Location Type | intronic |
| Hg19 Start | 614818 |
| Hg19 End | 614818 |
| Hg38 Start | 573135 |
| Hg38 End | 573135 |
| Junction Sequence | TCCGTAGAGAAACCCAGCTGTAATCATGCATGGAGATACACCTACATTGCATGAATATATGTTAGATTTGCAACCAGAGACAACTGATCTCTACTGTTATGAGCAATTAAGTGACAGCTCAGAGGAGGAGGATGAAATAGATACTTCTTCAAAATAGAAAAGGGGAGTAGGGCTATTCAGGGAACCAATGACTCAAAAATTCCTATGGACATATACACCATGGAATACTATGCAGCCATAAAAAGGAAAAAATAAT |
| Target Gene ▶ | |
| Target Gene | LINC01266 |
| Nearby Gene | - |
| Distance | - |
| Virus Information ▶ | |
| Virus Name | Human Papillomavirus |
| Virus Subtype Name | HPV16 |
| Virus Genome Accession | AF534061 |
| TaxonomyID | 10566 |
| Virus Abbreviation | HPV |
| Virus Genome | Human papillomavirus type 16 East Asian type, complete genome |
| Virus Genome Length | 7905 bp |
| Virus Breakpoint1 | 677 |
| Virus Breakpoint2 | - |
| Virus Gene Name | HpV16gp2_E7 |
| Virus Region Type | - |
| Integrated Virus Sequence | - |
| ViMIC ID | - |
| Predicted VIS Effect ▶ | |
| Gene Id | ENSG00000224957.8 |
| Gene Name | LINC01266 |
| Region | intron |
| Impact | intronic_insertion |
| Transcript | Transcript 1: ENST00000661103.1, Transcript 2: ENST00000794135.1, Transcript 3: ENST00000668617.2, Transcript 4: ENST00000794134.1, Transcript 5: ENST00000794130.1, Transcript 6: ENST00000656558.1, Transcript 7: ENST00000667456.3, Transcript 8: ENST00000661877.1, Transcript 9: ENST00000794136.1, Transcript 10: ENST00000794131.1, Transcript 11: ENST00000794133.1, Transcript 12: ENST00000794137.1, Transcript 13: ENST00000794141.1, Transcript 14: ENST00000794138.1, Transcript 15: ENST00000420823.5, Transcript 16: ENST00000794132.1, Transcript 17: ENST00000794129.1, Transcript 18: ENST00000655067.2, Transcript 19: ENST00000794139.1, Transcript 20: ENST00000794140.1, Transcript 21: ENST00000702265.1, Transcript 22: ENST00000442809.1, Transcript 23: ENST00000661727.1, Transcript 24: ENST00000653731.1 |
| AlphaGenome Analysis | |
| Window | chr3:507599-638671 |
| RNA-seq Change (±2kb) | Mean: -2.9497432478819974e-05 | Peak: 0.212890625 |
| ATAC Change (±2kb) | Mean: -0.0006845403113402426 | Peak: 1.866943359375 |
| Interpretation | RNA-seq: no signal in region (REF≈0, ALT≈0) | Splice sites: no signal in region (REF≈0, ALT≈0) | ATAC: minimal change -3.0% |
| Visualization | |
Center for Precision Health
McWilliams School of Biomedical Informatics at UTHealth Houston
7000 Fannin Street, Suite 600, Houston, TX 77030
Email: Zhongming Zhao, Ph.D