Virus Integration Site Database Data Release 2.0

Details for VISDB ID: TVIS20033623

Genomic Region Visualization (IGV)

Basic Information ▶
VISDB IDTVIS20033623
Fusion NameHPV-ENSG00000289219 integration
ValidatedNo
Curated WayCurated
MethodHigh-throughput Viral Integration Detection method
Wet AssayYes
Sample ID-
Sample NameS025
Sample TypeTumor
Age57 = 59; >57 = 50
Gender-
Disease Information ▶
Disease NameOropharyngeal squamous cell carcinoma
Disease AbbreviationOPSCC
CancerYes
Literature ▶
PubMed ID38279874
JournalClinical and Translational Medicine
Published Year2024
Human Genome ▶
Human Genome Version DescriptionGRCh37/hg19
Human Genome RefSeq AccessionGCF_000001405.13
Human Chromosomechr3
Cytogenetic Bandq29
Human Strand-
Human Integration Location Typeintronic
Hg19 Start195867952
Hg19 End195867952
Hg38 Start196141081
Hg38 End196141081
Junction SequenceCTGAAGTGGAAACTCAGCAGATGTTACAGGTAGAAGGGCGCCATGAGACTGAAACACCATGTAGTCAGTATAGTGGTGGAAGTGGGGGTGGTTGCAGTCAGTACAGTAGTGGAAGTGGGGGAGAGGGTGCCAGTGGCCTGGACCTGCTTCCCCTCCCCGGGTGCCTCCGCGGGAGCCCCTGTCCCCTCAAGGCTCGAGG
Target Gene ▶
Target GeneENSG00000289219
Nearby Gene-
Distance-
Virus Information ▶
Virus NameHuman Papillomavirus
Virus Subtype NameHPV16
Virus Genome AccessionAF534061
TaxonomyID10566
Virus AbbreviationHPV
Virus GenomeHuman papillomavirus type 16 East Asian type, complete genome
Virus Genome Length7905 bp
Virus Breakpoint11401
Virus Breakpoint2-
Virus Gene NameHpV16gp3_E1
Virus Region Type-
Integrated Virus Sequence-
ViMIC ID-
Predicted VIS Effect ▶
TranscriptTranscript 1: ENST00000745236.1, Transcript 2: ENST00000745237.1, Transcript 3: ENST00000745239.1, Transcript 4: ENST00000745238.1, Transcript 5: ENST00000659409.3, Transcript 6: ENST00000654470.3, Transcript 7: ENST00000670584.3, Transcript 8: ENST00000744823.1, Transcript 9: ENST00000457079.4, Transcript 10: ENST00000662916.2, Transcript 11: ENST00000669905.3, Transcript 12: ENST00000744821.1, Transcript 13: ENST00000744822.1, Transcript 14: ENST00000662113.2, Transcript 15: ENST00000744827.1, Transcript 16: ENST00000744824.1, Transcript 17: ENST00000702140.2, Transcript 18: ENST00000744825.1, Transcript 19: ENST00000744814.1, Transcript 20: ENST00000744826.1, Transcript 21: ENST00000744816.1, Transcript 22: ENST00000744849.1, Transcript 23: ENST00000744845.1, Transcript 24: ENST00000689269.2, Transcript 25: ENST00000744828.1, Transcript 26: ENST00000744846.1, Transcript 27: ENST00000744830.1, Transcript 28: ENST00000744829.1, Transcript 29: ENST00000744819.1, Transcript 30: ENST00000744815.1, Transcript 31: ENST00000744831.1, Transcript 32: ENST00000744832.1, Transcript 33: ENST00000744817.1, Transcript 34: ENST00000687908.1, Transcript 35: ENST00000744818.1
Transcript 1 Gene IdENSG00000289219.2
Transcript 1 Gene NameENSG00000289219
Transcript 1 Regionintron
Transcript 1 Impactintronic_insertion
Transcript 2 Gene IdENSG00000289219.2
Transcript 2 Gene NameENSG00000289219
Transcript 2 Regionintron
Transcript 2 Impactintronic_insertion
Transcript 3 Gene IdENSG00000289219.2
Transcript 3 Gene NameENSG00000289219
Transcript 3 Regionintron
Transcript 3 Impactintronic_insertion
Transcript 4 Gene IdENSG00000289219.2
Transcript 4 Gene NameENSG00000289219
Transcript 4 Regionintron
Transcript 4 Impactintronic_insertion
Transcript 5 Gene IdENSG00000224652.5
Transcript 5 Gene NameLINC00885
Transcript 5 Regionpromoter
Transcript 5 Impactpromoter_insertion
Transcript 6 Gene IdENSG00000224652.5
Transcript 6 Gene NameLINC00885
Transcript 6 Regionpromoter
Transcript 6 Impactpromoter_insertion
Transcript 7 Gene IdENSG00000224652.5
Transcript 7 Gene NameLINC00885
Transcript 7 Regionpromoter
Transcript 7 Impactpromoter_insertion
Transcript 8 Gene IdENSG00000224652.5
Transcript 8 Gene NameLINC00885
Transcript 8 Regionpromoter
Transcript 8 Impactpromoter_insertion
Transcript 9 Gene IdENSG00000224652.5
Transcript 9 Gene NameLINC00885
Transcript 9 Regionpromoter
Transcript 9 Impactpromoter_insertion
Transcript 10 Gene IdENSG00000224652.5
Transcript 10 Gene NameLINC00885
Transcript 10 Regionpromoter
Transcript 10 Impactpromoter_insertion
Transcript 11 Gene IdENSG00000224652.5
Transcript 11 Gene NameLINC00885
Transcript 11 Regionpromoter
Transcript 11 Impactpromoter_insertion
Transcript 12 Gene IdENSG00000224652.5
Transcript 12 Gene NameLINC00885
Transcript 12 Regionpromoter
Transcript 12 Impactpromoter_insertion
Transcript 13 Gene IdENSG00000224652.5
Transcript 13 Gene NameLINC00885
Transcript 13 Regionpromoter
Transcript 13 Impactpromoter_insertion
Transcript 14 Gene IdENSG00000224652.5
Transcript 14 Gene NameLINC00885
Transcript 14 Regionpromoter
Transcript 14 Impactpromoter_insertion
Transcript 15 Gene IdENSG00000224652.5
Transcript 15 Gene NameLINC00885
Transcript 15 Regionpromoter
Transcript 15 Impactpromoter_insertion
Transcript 16 Gene IdENSG00000224652.5
Transcript 16 Gene NameLINC00885
Transcript 16 Regionpromoter
Transcript 16 Impactpromoter_insertion
Transcript 17 Gene IdENSG00000224652.5
Transcript 17 Gene NameLINC00885
Transcript 17 Regionpromoter
Transcript 17 Impactpromoter_insertion
Transcript 18 Gene IdENSG00000224652.5
Transcript 18 Gene NameLINC00885
Transcript 18 Regionpromoter
Transcript 18 Impactpromoter_insertion
Transcript 19 Gene IdENSG00000224652.5
Transcript 19 Gene NameLINC00885
Transcript 19 Regionpromoter
Transcript 19 Impactpromoter_insertion
Transcript 20 Gene IdENSG00000224652.5
Transcript 20 Gene NameLINC00885
Transcript 20 Regionpromoter
Transcript 20 Impactpromoter_insertion
Transcript 21 Gene IdENSG00000224652.5
Transcript 21 Gene NameLINC00885
Transcript 21 Regionpromoter
Transcript 21 Impactpromoter_insertion
Transcript 22 Gene IdENSG00000224652.5
Transcript 22 Gene NameLINC00885
Transcript 22 Regionpromoter
Transcript 22 Impactpromoter_insertion
Transcript 23 Gene IdENSG00000224652.5
Transcript 23 Gene NameLINC00885
Transcript 23 Regionpromoter
Transcript 23 Impactpromoter_insertion
Transcript 24 Gene IdENSG00000224652.5
Transcript 24 Gene NameLINC00885
Transcript 24 Regionpromoter
Transcript 24 Impactpromoter_insertion
Transcript 25 Gene IdENSG00000224652.5
Transcript 25 Gene NameLINC00885
Transcript 25 Regionpromoter
Transcript 25 Impactpromoter_insertion
Transcript 26 Gene IdENSG00000224652.5
Transcript 26 Gene NameLINC00885
Transcript 26 Regionpromoter
Transcript 26 Impactpromoter_insertion
Transcript 27 Gene IdENSG00000224652.5
Transcript 27 Gene NameLINC00885
Transcript 27 Regionpromoter
Transcript 27 Impactpromoter_insertion
Transcript 28 Gene IdENSG00000224652.5
Transcript 28 Gene NameLINC00885
Transcript 28 Regionpromoter
Transcript 28 Impactpromoter_insertion
Transcript 29 Gene IdENSG00000224652.5
Transcript 29 Gene NameLINC00885
Transcript 29 Regionpromoter
Transcript 29 Impactpromoter_insertion
Transcript 30 Gene IdENSG00000224652.5
Transcript 30 Gene NameLINC00885
Transcript 30 Regionpromoter
Transcript 30 Impactpromoter_insertion
Transcript 31 Gene IdENSG00000224652.5
Transcript 31 Gene NameLINC00885
Transcript 31 Regionpromoter
Transcript 31 Impactpromoter_insertion
Transcript 32 Gene IdENSG00000224652.5
Transcript 32 Gene NameLINC00885
Transcript 32 Regionpromoter
Transcript 32 Impactpromoter_insertion
Transcript 33 Gene IdENSG00000224652.5
Transcript 33 Gene NameLINC00885
Transcript 33 Regionpromoter
Transcript 33 Impactpromoter_insertion
Transcript 34 Gene IdENSG00000224652.5
Transcript 34 Gene NameLINC00885
Transcript 34 Regionpromoter
Transcript 34 Impactpromoter_insertion
Transcript 35 Gene IdENSG00000224652.5
Transcript 35 Gene NameLINC00885
Transcript 35 Regionpromoter
Transcript 35 Impactpromoter_insertion
AlphaGenome Analysis
Windowchr3:196075545-196206617
RNA-seq Change (±2kb)Mean: -0.00031269408646039665 | Peak: 0.61767578125
ATAC Change (±2kb)Mean: 0.006597399711608887 | Peak: 20.25
InterpretationRNA-seq: no signal in region (REF≈0, ALT≈0) | Splice sites: no signal in region (REF≈0, ALT≈0) | ATAC: INCREASED 10.7% (REF=0.06, ALT=0.07)
Visualization
Related Links: VISDB1.0  |  UCSC  |  NCBI  |  Ensembl  |  OncoKB  |  ONGene  |  HumCFS  |  COSMIC  |  miRTarBase  |  NPInter  |  ATACdb  |  ENCODE  |  Cytoscape
UTHealth Logo

Center for Precision Health

McWilliams School of Biomedical Informatics at UTHealth Houston

7000 Fannin Street, Suite 600, Houston, TX 77030

Email: Zhongming Zhao, Ph.D

Copyright © 2025   Bioinformatics and Systems Medicine Lab.   All Rights Reserved.
Site Policies  |   Emergency Information  |   Campus Carry  |   CPH