| Basic Information ▶ | |
| VISDB ID | TVIS20033918 |
|---|---|
| Fusion Name | HPV-ADCY8 integration |
| Validated | No |
| Curated Way | Curated |
| Method | High-throughput Viral Integration Detection method |
| Wet Assay | Yes |
| Sample ID | - |
| Sample Name | S030 |
| Sample Type | Tumor |
| Age | 57 = 59; >57 = 50 |
| Gender | - |
| Disease Information ▶ | |
| Disease Name | Oropharyngeal squamous cell carcinoma |
| Disease Abbreviation | OPSCC |
| Cancer | Yes |
| Literature ▶ | |
| PubMed ID | 38279874 |
| Journal | Clinical and Translational Medicine |
| Published Year | 2024 |
| Human Genome ▶ | |
| Human Genome Version Description | GRCh37/hg19 |
| Human Genome RefSeq Accession | GCF_000001405.13 |
| Human Chromosome | chr8 |
| Cytogenetic Band | q24.22 |
| Human Strand | + |
| Human Integration Location Type | exonic |
| Hg19 Start | 132051660 |
| Hg19 End | 132051660 |
| Hg38 Start | 131039414 |
| Hg38 End | 131039414 |
| Junction Sequence | GGCACACTAGGAATTGTGTGCCCCATCTGTTCCCAGAAACCATAATCTACCATGGCTGATCCTGCAGGTACCAATGGGGAAGAGGGTACGGGATGTAATGGATGGTTTTATGTAGAGGCTGTAGTGGAAAAAAATGGACTCCTGGCGGTAACATGTGGGAAATGGCGTCCAACTTAAGACCGAGGACCTGCCTCAGCCCCACCCCCCGATTAGCTGGGATTACAGGC |
| Target Gene ▶ | |
| Target Gene | ADCY8, ENSG00000297096 |
| Nearby Gene | - |
| Distance | - |
| Virus Information ▶ | |
| Virus Name | Human Papillomavirus |
| Virus Subtype Name | HPV16 |
| Virus Genome Accession | AF534061 |
| TaxonomyID | 10566 |
| Virus Abbreviation | HPV |
| Virus Genome | Human papillomavirus type 16 East Asian type, complete genome |
| Virus Genome Length | 7905 bp |
| Virus Breakpoint1 | 946 |
| Virus Breakpoint2 | - |
| Virus Gene Name | HpV16gp3_E1 |
| Virus Region Type | - |
| Integrated Virus Sequence | - |
| ViMIC ID | - |
| Predicted VIS Effect ▶ | |
| Transcript | Transcript 1: ENST00000912159.1, Transcript 2: ENST00000286355.10, Transcript 3: ENST00000912161.1, Transcript 4: ENST00000912160.1, Transcript 5: ENST00000377928.7, Transcript 6: ENST00000745365.1, Transcript 7: ENST00000745368.1, Transcript 8: ENST00000745369.1, Transcript 9: ENST00000745370.1, Transcript 10: ENST00000745366.1, Transcript 11: ENST00000745371.1, Transcript 12: ENST00000745367.1 |
| Transcript 1 Gene Id | ENSG00000155897.11 |
| Transcript 1 Gene Name | ADCY8 |
| Transcript 1 Region | CDS |
| Transcript 1 Impact | stop_gained |
| Transcript 1 Frameshift | True |
| Transcript 1 Stop Gained | True |
| Transcript 1 Protein Change From Aa0 | 306 |
| Transcript 2 Gene Id | ENSG00000155897.11 |
| Transcript 2 Gene Name | ADCY8 |
| Transcript 2 Region | CDS |
| Transcript 2 Impact | stop_gained |
| Transcript 2 Frameshift | True |
| Transcript 2 Stop Gained | True |
| Transcript 2 Protein Change From Aa0 | 306 |
| Transcript 3 Gene Id | ENSG00000155897.11 |
| Transcript 3 Gene Name | ADCY8 |
| Transcript 3 Region | CDS |
| Transcript 3 Impact | stop_gained |
| Transcript 3 Frameshift | True |
| Transcript 3 Stop Gained | True |
| Transcript 3 Protein Change From Aa0 | 306 |
| Transcript 4 Gene Id | ENSG00000155897.11 |
| Transcript 4 Gene Name | ADCY8 |
| Transcript 4 Region | CDS |
| Transcript 4 Impact | stop_gained |
| Transcript 4 Frameshift | True |
| Transcript 4 Stop Gained | True |
| Transcript 4 Protein Change From Aa0 | 306 |
| Transcript 5 Gene Id | ENSG00000155897.11 |
| Transcript 5 Gene Name | ADCY8 |
| Transcript 5 Region | CDS |
| Transcript 5 Impact | stop_gained |
| Transcript 5 Frameshift | True |
| Transcript 5 Stop Gained | True |
| Transcript 5 Protein Change From Aa0 | 306 |
| Transcript 6 Gene Id | ENSG00000297096.1 |
| Transcript 6 Gene Name | ENSG00000297096 |
| Transcript 6 Region | exon_non_coding |
| Transcript 6 Impact | noncoding_exon_insertion |
| Transcript 7 Gene Id | ENSG00000297096.1 |
| Transcript 7 Gene Name | ENSG00000297096 |
| Transcript 7 Region | exon_non_coding |
| Transcript 7 Impact | noncoding_exon_insertion |
| Transcript 8 Gene Id | ENSG00000297096.1 |
| Transcript 8 Gene Name | ENSG00000297096 |
| Transcript 8 Region | exon_non_coding |
| Transcript 8 Impact | noncoding_exon_insertion |
| Transcript 9 Gene Id | ENSG00000297096.1 |
| Transcript 9 Gene Name | ENSG00000297096 |
| Transcript 9 Region | exon_non_coding |
| Transcript 9 Impact | noncoding_exon_insertion |
| Transcript 10 Gene Id | ENSG00000297096.1 |
| Transcript 10 Gene Name | ENSG00000297096 |
| Transcript 10 Region | promoter |
| Transcript 10 Impact | promoter_insertion |
| Transcript 11 Gene Id | ENSG00000297096.1 |
| Transcript 11 Gene Name | ENSG00000297096 |
| Transcript 11 Region | promoter |
| Transcript 11 Impact | promoter_insertion |
| Transcript 12 Gene Id | ENSG00000297096.1 |
| Transcript 12 Gene Name | ENSG00000297096 |
| Transcript 12 Region | promoter |
| Transcript 12 Impact | promoter_insertion |
| SpliceAI Score | |
| Delta Scores | Acceptor Gain: 0.050 | Acceptor Loss: 0.200 | Donor Gain: 0.250 | Donor Loss: 0.670 |
| Delta Score Max | 0.670 |
| Delta Position at Max | -40 |
| Delta Score Flag | RECOMMENDED |
| Gene | ADCY8 |
| Altered Protein (FASTA) | |
| AlphaGenome Analysis | |
| Window | chr8:130973878-131104950 |
| RNA-seq Change (±2kb) | Mean: 0.00389954075217247 | Peak: 0.5103759765625 |
| ATAC Change (±2kb) | Mean: -0.0010910176206380129 | Peak: 16.6640625 |
| Interpretation | RNA-seq: minimal change (delta=0.00) | Splice sites: no signal in region (REF≈0, ALT≈0) | ATAC: minimal change -2.5% |
| Visualization | |
Center for Precision Health
McWilliams School of Biomedical Informatics at UTHealth Houston
7000 Fannin Street, Suite 600, Houston, TX 77030
Email: Zhongming Zhao, Ph.D