Virus Integration Site Database Data Release 2.0

Details for VISDB ID: TVIS20038463

Genomic Region Visualization (IGV)

Basic Information ▶
VISDB IDTVIS20038463
Fusion NameHPV-UBE2Q2 integration
ValidatedNo
Curated WayCurated
MethodHigh-throughput Viral Integration Detection method
Wet AssayYes
Sample ID-
Sample NameS100
Sample TypeTumor
Age57 = 59; >57 = 50
Gender-
Disease Information ▶
Disease NameOropharyngeal squamous cell carcinoma
Disease AbbreviationOPSCC
CancerYes
Literature ▶
PubMed ID38279874
JournalClinical and Translational Medicine
Published Year2024
Human Genome ▶
Human Genome Version DescriptionGRCh37/hg19
Human Genome RefSeq AccessionGCF_000001405.13
Human Chromosomechr15
Cytogenetic Bandq24.2
Human Strand+
Human Integration Location Typeintronic
Hg19 Start76185564
Hg19 End76185564
Hg38 Start75893223
Hg38 End75893223
Junction SequenceATTTATGTCTATATGACAAATCTTGATACTGCATCCACAACATTACTGGCGTGCTTTTTGCTTTGCTTTTGAAGTCCTTGTTTGTTCACTCAAATATTTACCCAGGTCAGCTTCTATTAACTGTTTTATGGCTTGATAAC
Target Gene ▶
Target GeneUBE2Q2, ENSG00000308033
Nearby Gene-
Distance-
Virus Information ▶
Virus NameHuman Papillomavirus
Virus Subtype NameHPV16
Virus Genome AccessionAF534061
TaxonomyID10566
Virus AbbreviationHPV
Virus GenomeHuman papillomavirus type 16 East Asian type, complete genome
Virus Genome Length7905 bp
Virus Breakpoint13907
Virus Breakpoint2-
Virus Gene NameHpV16gp6_E5
Virus Region Type-
Integrated Virus Sequence-
ViMIC ID-
Predicted VIS Effect ▶
TranscriptTranscript 1: ENST00000569423.5, Transcript 2: ENST00000872676.1, Transcript 3: ENST00000872678.1, Transcript 4: ENST00000872677.1, Transcript 5: ENST00000872681.1, Transcript 6: ENST00000872679.1, Transcript 7: ENST00000872680.1, Transcript 8: ENST00000872682.1, Transcript 9: ENST00000872683.1, Transcript 10: ENST00000872684.1, Transcript 11: ENST00000872685.1, Transcript 12: ENST00000931648.1, Transcript 13: ENST00000267938.9, Transcript 14: ENST00000931650.1, Transcript 15: ENST00000931649.1, Transcript 16: ENST00000872686.1, Transcript 17: ENST00000872689.1, Transcript 18: ENST00000872687.1, Transcript 19: ENST00000872688.1, Transcript 20: ENST00000942849.1, Transcript 21: ENST00000872690.1, Transcript 22: ENST00000872691.1, Transcript 23: ENST00000872692.1, Transcript 24: ENST00000872693.1, Transcript 25: ENST00000942850.1, Transcript 26: ENST00000561723.5, Transcript 27: ENST00000942851.1, Transcript 28: ENST00000561851.5, Transcript 29: ENST00000426727.6, Transcript 30: ENST00000567921.1, Transcript 31: ENST00000563966.1, Transcript 32: ENST00000830572.1, Transcript 33: ENST00000581311.2
Transcript 1 Gene IdENSG00000140367.13
Transcript 1 Gene NameUBE2Q2
Transcript 1 Regionintron
Transcript 1 Impactintronic_insertion
Transcript 2 Gene IdENSG00000140367.13
Transcript 2 Gene NameUBE2Q2
Transcript 2 Regionintron
Transcript 2 Impactintronic_insertion
Transcript 3 Gene IdENSG00000140367.13
Transcript 3 Gene NameUBE2Q2
Transcript 3 Regionintron
Transcript 3 Impactintronic_insertion
Transcript 4 Gene IdENSG00000140367.13
Transcript 4 Gene NameUBE2Q2
Transcript 4 Regionintron
Transcript 4 Impactintronic_insertion
Transcript 5 Gene IdENSG00000140367.13
Transcript 5 Gene NameUBE2Q2
Transcript 5 Regionintron
Transcript 5 Impactintronic_insertion
Transcript 6 Gene IdENSG00000140367.13
Transcript 6 Gene NameUBE2Q2
Transcript 6 Regionintron
Transcript 6 Impactintronic_insertion
Transcript 7 Gene IdENSG00000140367.13
Transcript 7 Gene NameUBE2Q2
Transcript 7 Regionintron
Transcript 7 Impactintronic_insertion
Transcript 8 Gene IdENSG00000140367.13
Transcript 8 Gene NameUBE2Q2
Transcript 8 Regionintron
Transcript 8 Impactintronic_insertion
Transcript 9 Gene IdENSG00000140367.13
Transcript 9 Gene NameUBE2Q2
Transcript 9 Regionintron
Transcript 9 Impactintronic_insertion
Transcript 10 Gene IdENSG00000140367.13
Transcript 10 Gene NameUBE2Q2
Transcript 10 Regionintron
Transcript 10 Impactintronic_insertion
Transcript 11 Gene IdENSG00000140367.13
Transcript 11 Gene NameUBE2Q2
Transcript 11 Regionintron
Transcript 11 Impactintronic_insertion
Transcript 12 Gene IdENSG00000140367.13
Transcript 12 Gene NameUBE2Q2
Transcript 12 Regionintron
Transcript 12 Impactintronic_insertion
Transcript 13 Gene IdENSG00000140367.13
Transcript 13 Gene NameUBE2Q2
Transcript 13 Regionintron
Transcript 13 Impactintronic_insertion
Transcript 14 Gene IdENSG00000140367.13
Transcript 14 Gene NameUBE2Q2
Transcript 14 Regionintron
Transcript 14 Impactintronic_insertion
Transcript 15 Gene IdENSG00000140367.13
Transcript 15 Gene NameUBE2Q2
Transcript 15 Regionintron
Transcript 15 Impactintronic_insertion
Transcript 16 Gene IdENSG00000140367.13
Transcript 16 Gene NameUBE2Q2
Transcript 16 Regionintron
Transcript 16 Impactintronic_insertion
Transcript 17 Gene IdENSG00000140367.13
Transcript 17 Gene NameUBE2Q2
Transcript 17 Regionintron
Transcript 17 Impactintronic_insertion
Transcript 18 Gene IdENSG00000140367.13
Transcript 18 Gene NameUBE2Q2
Transcript 18 Regionintron
Transcript 18 Impactintronic_insertion
Transcript 19 Gene IdENSG00000140367.13
Transcript 19 Gene NameUBE2Q2
Transcript 19 Regionintron
Transcript 19 Impactintronic_insertion
Transcript 20 Gene IdENSG00000140367.13
Transcript 20 Gene NameUBE2Q2
Transcript 20 Regionintron
Transcript 20 Impactintronic_insertion
Transcript 21 Gene IdENSG00000140367.13
Transcript 21 Gene NameUBE2Q2
Transcript 21 Regionintron
Transcript 21 Impactintronic_insertion
Transcript 22 Gene IdENSG00000140367.13
Transcript 22 Gene NameUBE2Q2
Transcript 22 Regionintron
Transcript 22 Impactintronic_insertion
Transcript 23 Gene IdENSG00000140367.13
Transcript 23 Gene NameUBE2Q2
Transcript 23 Regionintron
Transcript 23 Impactintronic_insertion
Transcript 24 Gene IdENSG00000140367.13
Transcript 24 Gene NameUBE2Q2
Transcript 24 Regionintron
Transcript 24 Impactintronic_insertion
Transcript 25 Gene IdENSG00000140367.13
Transcript 25 Gene NameUBE2Q2
Transcript 25 Regionintron
Transcript 25 Impactintronic_insertion
Transcript 26 Gene IdENSG00000140367.13
Transcript 26 Gene NameUBE2Q2
Transcript 26 Regionintron
Transcript 26 Impactintronic_insertion
Transcript 27 Gene IdENSG00000140367.13
Transcript 27 Gene NameUBE2Q2
Transcript 27 Regionintron
Transcript 27 Impactintronic_insertion
Transcript 28 Gene IdENSG00000140367.13
Transcript 28 Gene NameUBE2Q2
Transcript 28 Regionintron
Transcript 28 Impactintronic_insertion
Transcript 29 Gene IdENSG00000140367.13
Transcript 29 Gene NameUBE2Q2
Transcript 29 Regionintron
Transcript 29 Impactintronic_insertion
Transcript 30 Gene IdENSG00000140367.13
Transcript 30 Gene NameUBE2Q2
Transcript 30 Regionintron
Transcript 30 Impactintronic_insertion
Transcript 31 Gene IdENSG00000140367.13
Transcript 31 Gene NameUBE2Q2
Transcript 31 Regionintron
Transcript 31 Impactintronic_insertion
Transcript 32 Gene IdENSG00000308033.1
Transcript 32 Gene NameENSG00000308033
Transcript 32 Regionintron
Transcript 32 Impactintronic_insertion
Transcript 33 Gene IdENSG00000266308.2
Transcript 33 Gene NameRN7SL510P
Transcript 33 Regionpromoter
Transcript 33 Impactpromoter_insertion
SpliceAI Score
Delta ScoresAcceptor Gain: 0.000 | Acceptor Loss: 0.010 | Donor Gain: 0.000 | Donor Loss: 0.030
Delta Score Max0.030
Delta Position at Max-2209
Delta Score FlagLOW
GeneUBE2Q2
AlphaGenome Analysis
Chromosomechr15
Related Links: VISDB1.0  |  UCSC  |  NCBI  |  Ensembl  |  OncoKB  |  ONGene  |  HumCFS  |  COSMIC  |  miRTarBase  |  NPInter  |  ATACdb  |  ENCODE  |  Cytoscape
UTHealth Logo

Center for Precision Health

McWilliams School of Biomedical Informatics at UTHealth Houston

7000 Fannin Street, Suite 600, Houston, TX 77030

Email: Zhongming Zhao, Ph.D

Copyright © 2025   Bioinformatics and Systems Medicine Lab.   All Rights Reserved.
Site Policies  |   Emergency Information  |   Campus Carry  |   CPH