| Basic Information ▶ | |
| VISDB ID | TVIS20038847 |
|---|---|
| Fusion Name | HPV-STXBP5 integration |
| Validated | No |
| Curated Way | Curated |
| Method | High-throughput Viral Integration Detection method |
| Wet Assay | Yes |
| Sample ID | - |
| Sample Name | S100 |
| Sample Type | Tumor |
| Age | 57 = 59; >57 = 50 |
| Gender | - |
| Disease Information ▶ | |
| Disease Name | Oropharyngeal squamous cell carcinoma |
| Disease Abbreviation | OPSCC |
| Cancer | Yes |
| Literature ▶ | |
| PubMed ID | 38279874 |
| Journal | Clinical and Translational Medicine |
| Published Year | 2024 |
| Human Genome ▶ | |
| Human Genome Version Description | GRCh37/hg19 |
| Human Genome RefSeq Accession | GCF_000001405.13 |
| Human Chromosome | chr6 |
| Cytogenetic Band | q24.3 |
| Human Strand | - |
| Human Integration Location Type | exonic |
| Hg19 Start | 147710961 |
| Hg19 End | 147710961 |
| Hg38 Start | 147389825 |
| Hg38 End | 147389825 |
| Junction Sequence | GATACCACACCTGCTATATTAGATATTAATAATACTGTTACTACTGTTACTACACATAATAATCCCACTTTTACTGACCCATCTGTATTGCAGCCTCCAACACCTGCAGAAACTGGAGGGCATTTTACACTTTCATCACACATATTCTTTTATAATTTGACACTAGCTAGGTAGTGTATATATAACAGGCACAAGACACTGTTTCT |
| Target Gene ▶ | |
| Target Gene | STXBP5 |
| Nearby Gene | - |
| Distance | - |
| Virus Information ▶ | |
| Virus Name | Human Papillomavirus |
| Virus Subtype Name | HPV16 |
| Virus Genome Accession | AF534061 |
| TaxonomyID | 10566 |
| Virus Abbreviation | HPV |
| Virus Genome | Human papillomavirus type 16 East Asian type, complete genome |
| Virus Genome Length | 7905 bp |
| Virus Breakpoint1 | 4789 |
| Virus Breakpoint2 | - |
| Virus Gene Name | HpV16gp7_L2 |
| Virus Region Type | - |
| Integrated Virus Sequence | - |
| ViMIC ID | - |
| Predicted VIS Effect ▶ | |
| Gene Id | ENSG00000164506.17 |
| Gene Name | STXBP5 |
| Impact | noncoding_exon_insertion |
| Transcript | Transcript 1: ENST00000706849.1, Transcript 2: ENST00000706850.1, Transcript 3: ENST00000321680.11, Transcript 4: ENST00000367481.7, Transcript 5: ENST00000367475.7, Transcript 6: ENST00000706854.1, Transcript 7: ENST00000706862.1, Transcript 8: ENST00000443556.2, Transcript 9: ENST00000706863.1, Transcript 10: ENST00000706864.1, Transcript 11: ENST00000706865.1 |
| Transcript 1 Region | 3UTR |
| Transcript 2 Region | 3UTR |
| Transcript 3 Region | 3UTR |
| Transcript 4 Region | 3UTR |
| Transcript 5 Region | 3UTR |
| Transcript 6 Region | 3UTR |
| Transcript 7 Region | exon_non_coding |
| Transcript 8 Region | exon_non_coding |
| Transcript 9 Region | exon_non_coding |
| Transcript 10 Region | exon_non_coding |
| Transcript 11 Region | exon_non_coding |
| SpliceAI Score | |
| Delta Scores | Acceptor Gain: 0.000 | Acceptor Loss: 0.100 | Donor Gain: 0.000 | Donor Loss: 0.050 |
| Delta Score Max | 0.100 |
| Delta Position at Max | -763 |
| Delta Score Flag | LOW |
| Gene | STXBP5 |
| AlphaGenome Analysis | |
| Chromosome | chr6 |
Center for Precision Health
McWilliams School of Biomedical Informatics at UTHealth Houston
7000 Fannin Street, Suite 600, Houston, TX 77030
Email: Zhongming Zhao, Ph.D