| Basic Information ▶ | |
| VISDB ID | TVIS20040614 |
|---|---|
| Fusion Name | HPV-MSN integration |
| Validated | No |
| Curated Way | Curated |
| Method | High-throughput Viral Integration Detection method |
| Wet Assay | Yes |
| Sample ID | - |
| Sample Name | S101 |
| Sample Type | Tumor |
| Age | 57 = 59; >57 = 50 |
| Gender | - |
| Disease Information ▶ | |
| Disease Name | Oropharyngeal squamous cell carcinoma |
| Disease Abbreviation | OPSCC |
| Cancer | Yes |
| Literature ▶ | |
| PubMed ID | 38279874 |
| Journal | Clinical and Translational Medicine |
| Published Year | 2024 |
| Human Genome ▶ | |
| Human Genome Version Description | GRCh37/hg19 |
| Human Genome RefSeq Accession | GCF_000001405.13 |
| Human Chromosome | chrX |
| Cytogenetic Band | q12 |
| Human Strand | + |
| Human Integration Location Type | exonic |
| Hg19 Start | 64887505 |
| Hg19 End | 64887505 |
| Hg38 Start | 65667638 |
| Hg38 End | 65667638 |
| Junction Sequence | GGGTACGGGATGTAATGGATGGTTTTATGTAGAGGCTGTAGTGGAAAAAAAAACAGGGGATGATGAAAATGTTTTAGAACTGGCTGAAGATGGTTTTTGCACAACGTTGTGAATGTACT |
| Target Gene ▶ | |
| Target Gene | MSN |
| Nearby Gene | - |
| Distance | - |
| Virus Information ▶ | |
| Virus Name | Human Papillomavirus |
| Virus Subtype Name | HPV16 |
| Virus Genome Accession | AF534061 |
| TaxonomyID | 10566 |
| Virus Abbreviation | HPV |
| Virus Genome | Human papillomavirus type 16 East Asian type, complete genome |
| Virus Genome Length | 7905 bp |
| Virus Breakpoint1 | 957 |
| Virus Breakpoint2 | - |
| Virus Gene Name | HpV16gp3_E1 |
| Virus Region Type | - |
| Integrated Virus Sequence | - |
| ViMIC ID | - |
| Predicted VIS Effect ▶ | |
| Gene Id | ENSG00000147065.19 |
| Gene Name | MSN |
| Transcript | Transcript 1: ENST00000609672.5, Transcript 2: ENST00000943362.1, Transcript 3: ENST00000697133.1, Transcript 4: ENST00000885865.1, Transcript 5: ENST00000915048.1, Transcript 6: ENST00000697134.1, Transcript 7: ENST00000697135.1, Transcript 8: ENST00000915049.1, Transcript 9: ENST00000360270.7, Transcript 10: ENST00000943363.1, Transcript 11: ENST00000697136.1, Transcript 12: ENST00000697137.1, Transcript 13: ENST00000697138.1, Transcript 14: ENST00000697139.1, Transcript 15: ENST00000697140.1 |
| Transcript 1 Region | intron |
| Transcript 1 Impact | intronic_insertion |
| Transcript 2 Region | intron |
| Transcript 2 Impact | intronic_insertion |
| Transcript 3 Region | 5UTR |
| Transcript 3 Impact | noncoding_exon_insertion |
| Transcript 4 Region | 5UTR |
| Transcript 4 Impact | noncoding_exon_insertion |
| Transcript 5 Region | 5UTR |
| Transcript 5 Impact | noncoding_exon_insertion |
| Transcript 6 Region | promoter |
| Transcript 6 Impact | promoter_insertion |
| Transcript 7 Region | promoter |
| Transcript 7 Impact | promoter_insertion |
| Transcript 8 Region | promoter |
| Transcript 8 Impact | promoter_insertion |
| Transcript 9 Region | promoter |
| Transcript 9 Impact | promoter_insertion |
| Transcript 10 Region | promoter |
| Transcript 10 Impact | promoter_insertion |
| Transcript 11 Region | promoter |
| Transcript 11 Impact | promoter_insertion |
| Transcript 12 Region | promoter |
| Transcript 12 Impact | promoter_insertion |
| Transcript 13 Region | promoter |
| Transcript 13 Impact | promoter_insertion |
| Transcript 14 Region | promoter |
| Transcript 14 Impact | promoter_insertion |
| Transcript 15 Region | promoter |
| Transcript 15 Impact | promoter_insertion |
| AlphaGenome Analysis | |
| Chromosome | chrX |
Center for Precision Health
McWilliams School of Biomedical Informatics at UTHealth Houston
7000 Fannin Street, Suite 600, Houston, TX 77030
Email: Zhongming Zhao, Ph.D