| Basic Information ▶ | |
| VISDB ID | TVIS20040658 |
|---|---|
| Fusion Name | HPV-ENSG00000299234 integration |
| Validated | No |
| Curated Way | Curated |
| Method | High-throughput Viral Integration Detection method |
| Wet Assay | Yes |
| Sample ID | - |
| Sample Name | S101 |
| Sample Type | Tumor |
| Age | 57 = 59; >57 = 50 |
| Gender | - |
| Disease Information ▶ | |
| Disease Name | Oropharyngeal squamous cell carcinoma |
| Disease Abbreviation | OPSCC |
| Cancer | Yes |
| Literature ▶ | |
| PubMed ID | 38279874 |
| Journal | Clinical and Translational Medicine |
| Published Year | 2024 |
| Human Genome ▶ | |
| Human Genome Version Description | GRCh37/hg19 |
| Human Genome RefSeq Accession | GCF_000001405.13 |
| Human Chromosome | chr17 |
| Cytogenetic Band | q22 |
| Human Strand | + |
| Human Integration Location Type | intronic |
| Hg19 Start | 51882307 |
| Hg19 End | 51882307 |
| Hg38 Start | 53804946 |
| Hg38 End | 53804946 |
| Junction Sequence | AAAATCTACCAAATCTTCACCTGTATCACTGTCATTTTCGTTCTCGTCATCTGATATAGCATCCCCTTTTTCATTTTTCCCAGTTAATCATTTGAATTCCCATAAGCCTTAGTACAAGAAAATCCAGGATCTCCCACTT |
| Target Gene ▶ | |
| Target Gene | ENSG00000299234, ENSG00000285939 |
| Nearby Gene | - |
| Distance | - |
| Virus Information ▶ | |
| Virus Name | Human Papillomavirus |
| Virus Subtype Name | HPV16 |
| Virus Genome Accession | AF534061 |
| TaxonomyID | 10566 |
| Virus Abbreviation | HPV |
| Virus Genome | Human papillomavirus type 16 East Asian type, complete genome |
| Virus Genome Length | 7905 bp |
| Virus Breakpoint1 | 950 |
| Virus Breakpoint2 | - |
| Virus Gene Name | HpV16gp3_E1 |
| Virus Region Type | - |
| Integrated Virus Sequence | - |
| ViMIC ID | - |
Center for Precision Health
McWilliams School of Biomedical Informatics at UTHealth Houston
7000 Fannin Street, Suite 600, Houston, TX 77030
Email: Zhongming Zhao, Ph.D