| Basic Information ▶ | |
| VISDB ID | TVIS20041302 |
|---|---|
| Fusion Name | HPV-VLDLR-AS1 integration |
| Validated | No |
| Curated Way | Curated |
| Method | High-throughput Viral Integration Detection method |
| Wet Assay | Yes |
| Sample ID | - |
| Sample Name | S105 |
| Sample Type | Tumor |
| Age | 57 = 59; >57 = 50 |
| Gender | - |
| Disease Information ▶ | |
| Disease Name | Oropharyngeal squamous cell carcinoma |
| Disease Abbreviation | OPSCC |
| Cancer | Yes |
| Literature ▶ | |
| PubMed ID | 38279874 |
| Journal | Clinical and Translational Medicine |
| Published Year | 2024 |
| Human Genome ▶ | |
| Human Genome Version Description | GRCh37/hg19 |
| Human Genome RefSeq Accession | GCF_000001405.13 |
| Human Chromosome | chr9 |
| Cytogenetic Band | p24.2 |
| Human Strand | - |
| Human Integration Location Type | intronic |
| Hg19 Start | 2485770 |
| Hg19 End | 2485770 |
| Hg38 Start | 2485770 |
| Hg38 End | 2485770 |
| Junction Sequence | AATGTATATGTACATAATGTAATTGTTACATATAATTGTTGTATACCATAACTTACTATTTTTTCTTTTTTATTTTTATATATAATTTTTTGAGGTACATGAGATATTTTGGTACAGGCATGCAATGTGTCAAAATCACATCACGGAGGCTTGAGTAT |
| Target Gene ▶ | |
| Target Gene | VLDLR-AS1 |
| Nearby Gene | - |
| Distance | - |
| Virus Information ▶ | |
| Virus Name | Human Papillomavirus |
| Virus Subtype Name | HPV16 |
| Virus Genome Accession | AF534061 |
| TaxonomyID | 10566 |
| Virus Abbreviation | HPV |
| Virus Genome | Human papillomavirus type 16 East Asian type, complete genome |
| Virus Genome Length | 7905 bp |
| Virus Breakpoint1 | 4190 |
| Virus Breakpoint2 | - |
| Virus Gene Name | HpV16gp7_L2;HpV16gp4_E2;HpV16gp5_E4;HpV16gp6_E5//upstream;downstream |
| Virus Region Type | - |
| Integrated Virus Sequence | - |
| ViMIC ID | - |
| Predicted VIS Effect ▶ | |
| Gene Id | ENSG00000236404.13 |
| Gene Name | VLDLR-AS1 |
| Region | intron |
| Impact | intronic_insertion |
| Transcript | Transcript 1: ENST00000742983.1, Transcript 2: ENST00000648733.1, Transcript 3: ENST00000657742.1, Transcript 4: ENST00000653026.1, Transcript 5: ENST00000667661.1, Transcript 6: ENST00000671040.1, Transcript 7: ENST00000416826.6, Transcript 8: ENST00000742986.1, Transcript 9: ENST00000668403.2, Transcript 10: ENST00000655564.1, Transcript 11: ENST00000657269.1, Transcript 12: ENST00000447278.2, Transcript 13: ENST00000742990.1, Transcript 14: ENST00000743003.1, Transcript 15: ENST00000743000.1, Transcript 16: ENST00000742996.1, Transcript 17: ENST00000742991.1, Transcript 18: ENST00000742992.1, Transcript 19: ENST00000742993.1, Transcript 20: ENST00000742994.1, Transcript 21: ENST00000742995.1, Transcript 22: ENST00000742997.1, Transcript 23: ENST00000742985.1, Transcript 24: ENST00000742984.1, Transcript 25: ENST00000743002.1, Transcript 26: ENST00000743001.1, Transcript 27: ENST00000742998.1, Transcript 28: ENST00000742999.1, Transcript 29: ENST00000743004.1, Transcript 30: ENST00000743006.1 |
| AlphaGenome Analysis | |
| Chromosome | chr9 |
Center for Precision Health
McWilliams School of Biomedical Informatics at UTHealth Houston
7000 Fannin Street, Suite 600, Houston, TX 77030
Email: Zhongming Zhao, Ph.D