| Basic Information ▶ | |
| VISDB ID | TVIS20044354 |
|---|---|
| Fusion Name | HPV-ENSG00000265043 integration |
| Validated | No |
| Curated Way | Curated |
| Method | High-throughput Viral Integration Detection method |
| Wet Assay | Yes |
| Sample ID | - |
| Sample Name | S112 |
| Sample Type | Tumor |
| Age | 57 = 59; >57 = 50 |
| Gender | - |
| Disease Information ▶ | |
| Disease Name | Oropharyngeal squamous cell carcinoma |
| Disease Abbreviation | OPSCC |
| Cancer | Yes |
| Literature ▶ | |
| PubMed ID | 38279874 |
| Journal | Clinical and Translational Medicine |
| Published Year | 2024 |
| Human Genome ▶ | |
| Human Genome Version Description | GRCh37/hg19 |
| Human Genome RefSeq Accession | GCF_000001405.13 |
| Human Chromosome | chr17 |
| Cytogenetic Band | p11.2 |
| Human Strand | + |
| Human Integration Location Type | exonic |
| Hg19 Start | 21362561 |
| Hg19 End | 21362561 |
| Hg38 Start | 21459249 |
| Hg38 End | 21459249 |
| Junction Sequence | ACTGCTAAACGCAAAAAACGTAAGCTGTAAGTATTGTATGTATGTTGACTCAGTGTTGTTTGTTGTTTATATGTCTGTATGTGCTTGTATGTGCTTGTAAATATTAAGTTGTATGTGTGTTTGTATGTATGAAAGGTGAGAGGACAGATGAATCAGTGGATGGATGAATGGATGGAT |
| Target Gene ▶ | |
| Target Gene | ENSG00000265043, ENSG00000264023, LINC02693 |
| Nearby Gene | - |
| Distance | - |
| Virus Information ▶ | |
| Virus Name | Human Papillomavirus |
| Virus Subtype Name | HPV16 |
| Virus Genome Accession | AF534061 |
| TaxonomyID | 10566 |
| Virus Abbreviation | HPV |
| Virus Genome | Human papillomavirus type 16 East Asian type, complete genome |
| Virus Genome Length | 7905 bp |
| Virus Breakpoint1 | 7255 |
| Virus Breakpoint2 | - |
| Virus Gene Name | HpV16gp8_L1//downstream |
| Virus Region Type | - |
| Integrated Virus Sequence | - |
| ViMIC ID | - |
| Predicted VIS Effect ▶ | |
| Transcript | Transcript 1: ENST00000667136.1, Transcript 2: ENST00000649112.1, Transcript 3: ENST00000654263.1, Transcript 4: ENST00000700860.1, Transcript 5: ENST00000717506.1, Transcript 6: ENST00000661785.2, Transcript 7: ENST00000717507.1, Transcript 8: ENST00000686062.2, Transcript 9: ENST00000657015.1, Transcript 10: ENST00000686415.1, Transcript 11: ENST00000701171.1, Transcript 12: ENST00000649041.1, Transcript 13: ENST00000701727.1, Transcript 14: ENST00000717508.1, Transcript 15: ENST00000577309.1, Transcript 16: ENST00000582990.2, Transcript 17: ENST00000753249.1, Transcript 18: ENST00000753248.1 |
| Transcript 1 Gene Id | ENSG00000212719.16 |
| Transcript 1 Gene Name | LINC02693 |
| Transcript 1 Region | intron |
| Transcript 1 Impact | intronic_insertion |
| Transcript 2 Gene Id | ENSG00000212719.16 |
| Transcript 2 Gene Name | LINC02693 |
| Transcript 2 Region | intron |
| Transcript 2 Impact | intronic_insertion |
| Transcript 3 Gene Id | ENSG00000212719.16 |
| Transcript 3 Gene Name | LINC02693 |
| Transcript 3 Region | intron |
| Transcript 3 Impact | intronic_insertion |
| Transcript 4 Gene Id | ENSG00000212719.16 |
| Transcript 4 Gene Name | LINC02693 |
| Transcript 4 Region | intron |
| Transcript 4 Impact | intronic_insertion |
| Transcript 5 Gene Id | ENSG00000212719.16 |
| Transcript 5 Gene Name | LINC02693 |
| Transcript 5 Region | intron |
| Transcript 5 Impact | intronic_insertion |
| Transcript 6 Gene Id | ENSG00000212719.16 |
| Transcript 6 Gene Name | LINC02693 |
| Transcript 6 Region | intron |
| Transcript 6 Impact | intronic_insertion |
| Transcript 7 Gene Id | ENSG00000212719.16 |
| Transcript 7 Gene Name | LINC02693 |
| Transcript 7 Region | promoter |
| Transcript 7 Impact | promoter_insertion |
| Transcript 8 Gene Id | ENSG00000212719.16 |
| Transcript 8 Gene Name | LINC02693 |
| Transcript 8 Region | intron |
| Transcript 8 Impact | intronic_insertion |
| Transcript 9 Gene Id | ENSG00000212719.16 |
| Transcript 9 Gene Name | LINC02693 |
| Transcript 9 Region | intron |
| Transcript 9 Impact | intronic_insertion |
| Transcript 10 Gene Id | ENSG00000212719.16 |
| Transcript 10 Gene Name | LINC02693 |
| Transcript 10 Region | intron |
| Transcript 10 Impact | intronic_insertion |
| Transcript 11 Gene Id | ENSG00000212719.16 |
| Transcript 11 Gene Name | LINC02693 |
| Transcript 11 Region | intron |
| Transcript 11 Impact | intronic_insertion |
| Transcript 12 Gene Id | ENSG00000212719.16 |
| Transcript 12 Gene Name | LINC02693 |
| Transcript 12 Region | intron |
| Transcript 12 Impact | intronic_insertion |
| Transcript 13 Gene Id | ENSG00000212719.16 |
| Transcript 13 Gene Name | LINC02693 |
| Transcript 13 Region | intron |
| Transcript 13 Impact | intronic_insertion |
| Transcript 14 Gene Id | ENSG00000212719.16 |
| Transcript 14 Gene Name | LINC02693 |
| Transcript 14 Region | intron |
| Transcript 14 Impact | intronic_insertion |
| Transcript 15 Gene Id | ENSG00000265043.1 |
| Transcript 15 Gene Name | ENSG00000265043 |
| Transcript 15 Region | exon_non_coding |
| Transcript 15 Impact | noncoding_exon_insertion |
| Transcript 16 Gene Id | ENSG00000264023.2 |
| Transcript 16 Gene Name | ENSG00000264023 |
| Transcript 16 Region | exon_non_coding |
| Transcript 16 Impact | noncoding_exon_insertion |
| Transcript 17 Gene Id | ENSG00000264023.2 |
| Transcript 17 Gene Name | ENSG00000264023 |
| Transcript 17 Region | intron |
| Transcript 17 Impact | intronic_insertion |
| Transcript 18 Gene Id | ENSG00000264023.2 |
| Transcript 18 Gene Name | ENSG00000264023 |
| Transcript 18 Region | intron |
| Transcript 18 Impact | intronic_insertion |
| AlphaGenome Analysis | |
| Window | chr17:21393713-21524785 |
| RNA-seq Change (±2kb) | Mean: 0.0001851341367000714 | Peak: 0.1910400390625 |
| ATAC Change (±2kb) | Mean: -0.0015505969058722258 | Peak: 3.5 |
| Interpretation | RNA-seq: no signal in region (REF≈0, ALT≈0) | Splice sites: no signal in region (REF≈0, ALT≈0) | ATAC: minimal change -1.9% |
| Visualization | |
Center for Precision Health
McWilliams School of Biomedical Informatics at UTHealth Houston
7000 Fannin Street, Suite 600, Houston, TX 77030
Email: Zhongming Zhao, Ph.D