| Basic Information ▶ | |
| VISDB ID | TVIS20045357 |
|---|---|
| Fusion Name | HPV-ARPP21 integration |
| Validated | No |
| Curated Way | Curated |
| Method | High-throughput Viral Integration Detection method |
| Wet Assay | Yes |
| Sample ID | - |
| Sample Name | S110 |
| Sample Type | Tumor |
| Age | 57 = 59; >57 = 50 |
| Gender | - |
| Disease Information ▶ | |
| Disease Name | Oropharyngeal squamous cell carcinoma |
| Disease Abbreviation | OPSCC |
| Cancer | Yes |
| Literature ▶ | |
| PubMed ID | 38279874 |
| Journal | Clinical and Translational Medicine |
| Published Year | 2024 |
| Human Genome ▶ | |
| Human Genome Version Description | GRCh37/hg19 |
| Human Genome RefSeq Accession | GCF_000001405.13 |
| Human Chromosome | chr3 |
| Cytogenetic Band | p22.3 |
| Human Strand | - |
| Human Integration Location Type | intronic |
| Hg19 Start | 35736275 |
| Hg19 End | 35736275 |
| Hg38 Start | 35694783 |
| Hg38 End | 35694783 |
| Junction Sequence | ATATGCAATACAATGCATTATACAAACTGGAAACATATATATATTTGTGAAGAAGCATCAGTAACTGTGGTAGAGGGTCAAGTTGACTATTATGGTTTATATTATGTTCATGAAGGAATACAAACCGATTTTCTATGTGGCAAGCACAGTAACAGGCACCTTACATGTATGATCTTAGCTCGCCTAAC |
| Target Gene ▶ | |
| Target Gene | ARPP21 |
| Nearby Gene | - |
| Distance | - |
| Virus Information ▶ | |
| Virus Name | Human Papillomavirus |
| Virus Subtype Name | HPV16 |
| Virus Genome Accession | AF534061 |
| TaxonomyID | 10566 |
| Virus Abbreviation | HPV |
| Virus Genome | Human papillomavirus type 16 East Asian type, complete genome |
| Virus Genome Length | 7905 bp |
| Virus Breakpoint1 | 3251 |
| Virus Breakpoint2 | - |
| Virus Gene Name | HpV16gp4_E2 |
| Virus Region Type | - |
| Integrated Virus Sequence | - |
| ViMIC ID | - |
| Predicted VIS Effect ▶ | |
| Gene Id | ENSG00000172995.18 |
| Gene Name | ARPP21 |
| Region | intron |
| Impact | intronic_insertion |
| Transcript | Transcript 1: ENST00000946207.1, Transcript 2: ENST00000684406.1, Transcript 3: ENST00000946209.1, Transcript 4: ENST00000946208.1, Transcript 5: ENST00000909278.1, Transcript 6: ENST00000946210.1, Transcript 7: ENST00000946211.1, Transcript 8: ENST00000444190.5, Transcript 9: ENST00000187397.8, Transcript 10: ENST00000946213.1, Transcript 11: ENST00000909279.1, Transcript 12: ENST00000946212.1, Transcript 13: ENST00000946214.1, Transcript 14: ENST00000946215.1, Transcript 15: ENST00000946222.1, Transcript 16: ENST00000946219.1, Transcript 17: ENST00000946216.1, Transcript 18: ENST00000946223.1, Transcript 19: ENST00000946221.1, Transcript 20: ENST00000946220.1, Transcript 21: ENST00000946217.1, Transcript 22: ENST00000946218.1, Transcript 23: ENST00000946224.1, Transcript 24: ENST00000417925.5, Transcript 25: ENST00000946225.1, Transcript 26: ENST00000446068.6, Transcript 27: ENST00000425289.5, Transcript 28: ENST00000427590.1, Transcript 29: ENST00000476327.1 |
| SpliceAI Score | |
| Delta Scores | Acceptor Gain: 0.010 | Acceptor Loss: 0.010 | Donor Gain: 0.000 | Donor Loss: 0.000 |
| Delta Score Max | 0.010 |
| Delta Position at Max | -132 |
| Delta Score Flag | LOW |
| Gene | ARPP21 |
| AlphaGenome Analysis | |
| Chromosome | chr3 |
Center for Precision Health
McWilliams School of Biomedical Informatics at UTHealth Houston
7000 Fannin Street, Suite 600, Houston, TX 77030
Email: Zhongming Zhao, Ph.D