| Basic Information ▶ | |
| VISDB ID | TVIS20047301 |
|---|---|
| Fusion Name | HPV-FHAD1 integration |
| Validated | No |
| Curated Way | Curated |
| Method | High-throughput Viral Integration Detection method |
| Wet Assay | Yes |
| Sample ID | - |
| Sample Name | S065 |
| Sample Type | Tumor |
| Age | 57 = 59; >57 = 50 |
| Gender | - |
| Disease Information ▶ | |
| Disease Name | Oropharyngeal squamous cell carcinoma |
| Disease Abbreviation | OPSCC |
| Cancer | Yes |
| Literature ▶ | |
| PubMed ID | 38279874 |
| Journal | Clinical and Translational Medicine |
| Published Year | 2024 |
| Human Genome ▶ | |
| Human Genome Version Description | GRCh37/hg19 |
| Human Genome RefSeq Accession | GCF_000001405.13 |
| Human Chromosome | chr1 |
| Cytogenetic Band | p36.21 |
| Human Strand | + |
| Human Integration Location Type | exonic |
| Hg19 Start | 15653570 |
| Hg19 End | 15653570 |
| Hg38 Start | 15327074 |
| Hg38 End | 15327074 |
| Junction Sequence | ATTTTTATTTACTTAATTAAAAAAAAAATTTTTTTTTGAGGTGGTGCATACAATATTCCTTTAGTATCAGGTCCTGATATACCCATTAATATAACTGACCAAGCTCCTTCATTACTTCCTATAGTTCCAGGGTCTCGCTCT |
| Target Gene ▶ | |
| Target Gene | FHAD1, EFHD2-AS1, FHAD1-AS1 |
| Nearby Gene | - |
| Distance | - |
| Virus Information ▶ | |
| Virus Name | Human Papillomavirus |
| Virus Subtype Name | HPV16 |
| Virus Genome Accession | AF534061 |
| TaxonomyID | 10566 |
| Virus Abbreviation | HPV |
| Virus Genome | Human papillomavirus type 16 East Asian type, complete genome |
| Virus Genome Length | 7905 bp |
| Virus Breakpoint1 | 5441 |
| Virus Breakpoint2 | - |
| Virus Gene Name | HpV16gp7_L2 |
| Virus Region Type | - |
| Integrated Virus Sequence | - |
| ViMIC ID | - |
| Predicted VIS Effect ▶ | |
| Transcript | Transcript 1: ENST00000683790.1, Transcript 2: ENST00000688493.1, Transcript 3: ENST00000968213.1, Transcript 4: ENST00000358897.8, Transcript 5: ENST00000940095.1, Transcript 6: ENST00000375998.8, Transcript 7: ENST00000375996.6, Transcript 8: ENST00000375997.8, Transcript 9: ENST00000524761.5, Transcript 10: ENST00000375995.3, Transcript 11: ENST00000459961.1, Transcript 12: ENST00000472131.5, Transcript 13: ENST00000471347.5, Transcript 14: ENST00000774218.1, Transcript 15: ENST00000428747.1 |
| Transcript 1 Gene Id | ENSG00000142621.22 |
| Transcript 1 Gene Name | FHAD1 |
| Transcript 1 Region | CDS |
| Transcript 1 Impact | stop_gained |
| Transcript 1 Frameshift | False |
| Transcript 1 Stop Gained | True |
| Transcript 1 Protein Change From Aa0 | 226 |
| Transcript 2 Gene Id | ENSG00000142621.22 |
| Transcript 2 Gene Name | FHAD1 |
| Transcript 2 Region | CDS |
| Transcript 2 Impact | stop_gained |
| Transcript 2 Frameshift | False |
| Transcript 2 Stop Gained | True |
| Transcript 2 Protein Change From Aa0 | 226 |
| Transcript 3 Gene Id | ENSG00000142621.22 |
| Transcript 3 Gene Name | FHAD1 |
| Transcript 3 Region | CDS |
| Transcript 3 Impact | stop_gained |
| Transcript 3 Frameshift | False |
| Transcript 3 Stop Gained | True |
| Transcript 3 Protein Change From Aa0 | 226 |
| Transcript 4 Gene Id | ENSG00000142621.22 |
| Transcript 4 Gene Name | FHAD1 |
| Transcript 4 Region | CDS |
| Transcript 4 Impact | stop_gained |
| Transcript 4 Frameshift | False |
| Transcript 4 Stop Gained | True |
| Transcript 4 Protein Change From Aa0 | 226 |
| Transcript 5 Gene Id | ENSG00000142621.22 |
| Transcript 5 Gene Name | FHAD1 |
| Transcript 5 Region | CDS |
| Transcript 5 Impact | stop_gained |
| Transcript 5 Frameshift | False |
| Transcript 5 Stop Gained | True |
| Transcript 5 Protein Change From Aa0 | 226 |
| Transcript 6 Gene Id | ENSG00000142621.22 |
| Transcript 6 Gene Name | FHAD1 |
| Transcript 6 Region | CDS |
| Transcript 6 Impact | stop_gained |
| Transcript 6 Frameshift | False |
| Transcript 6 Stop Gained | True |
| Transcript 6 Protein Change From Aa0 | 226 |
| Transcript 7 Gene Id | ENSG00000142621.22 |
| Transcript 7 Gene Name | FHAD1 |
| Transcript 7 Region | exon_non_coding |
| Transcript 7 Impact | noncoding_exon_insertion |
| Transcript 8 Gene Id | ENSG00000142621.22 |
| Transcript 8 Gene Name | FHAD1 |
| Transcript 8 Region | CDS |
| Transcript 8 Impact | stop_gained |
| Transcript 8 Frameshift | False |
| Transcript 8 Stop Gained | True |
| Transcript 8 Protein Change From Aa0 | 65 |
| Transcript 9 Gene Id | ENSG00000142621.22 |
| Transcript 9 Gene Name | FHAD1 |
| Transcript 9 Region | CDS |
| Transcript 9 Impact | stop_gained |
| Transcript 9 Frameshift | False |
| Transcript 9 Stop Gained | True |
| Transcript 9 Protein Change From Aa0 | 46 |
| Transcript 10 Gene Id | ENSG00000142621.22 |
| Transcript 10 Gene Name | FHAD1 |
| Transcript 10 Region | CDS |
| Transcript 10 Impact | stop_gained |
| Transcript 10 Frameshift | False |
| Transcript 10 Stop Gained | True |
| Transcript 10 Protein Change From Aa0 | 65 |
| Transcript 11 Gene Id | ENSG00000142621.22 |
| Transcript 11 Gene Name | FHAD1 |
| Transcript 11 Region | exon_non_coding |
| Transcript 11 Impact | noncoding_exon_insertion |
| Transcript 12 Gene Id | ENSG00000142621.22 |
| Transcript 12 Gene Name | FHAD1 |
| Transcript 12 Region | exon_non_coding |
| Transcript 12 Impact | noncoding_exon_insertion |
| Transcript 13 Gene Id | ENSG00000142621.22 |
| Transcript 13 Gene Name | FHAD1 |
| Transcript 13 Region | promoter |
| Transcript 13 Impact | promoter_insertion |
| Transcript 14 Gene Id | ENSG00000228140.3 |
| Transcript 14 Gene Name | EFHD2-AS1 |
| Transcript 14 Region | intron |
| Transcript 14 Impact | intronic_insertion |
| Transcript 15 Gene Id | ENSG00000233485.2 |
| Transcript 15 Gene Name | FHAD1-AS1 |
| Transcript 15 Region | exon_non_coding |
| Transcript 15 Impact | noncoding_exon_insertion |
| SpliceAI Score | |
| Delta Scores | Acceptor Gain: 1.000 | Acceptor Loss: 0.990 | Donor Gain: 0.020 | Donor Loss: 0.020 |
| Delta Score Max | 1.000 |
| Delta Position at Max | 0 |
| Delta Score Flag | HIGH_PRECISION |
| Gene | FHAD1 |
| Altered Protein (FASTA) | |
| AlphaGenome Analysis | |
| Chromosome | chr1 |
Center for Precision Health
McWilliams School of Biomedical Informatics at UTHealth Houston
7000 Fannin Street, Suite 600, Houston, TX 77030
Email: Zhongming Zhao, Ph.D