| Basic Information ▶ | |
| VISDB ID | TVIS20055778 |
|---|---|
| Fusion Name | HPV-PYGB integration |
| Validated | No |
| Curated Way | Curated |
| Method | High-throughput Viral Integration Detection method |
| Wet Assay | Yes |
| Sample ID | - |
| Sample Name | S101 |
| Sample Type | Tumor |
| Age | 57 = 59; >57 = 50 |
| Gender | - |
| Disease Information ▶ | |
| Disease Name | Oropharyngeal squamous cell carcinoma |
| Disease Abbreviation | OPSCC |
| Cancer | Yes |
| Literature ▶ | |
| PubMed ID | 38279874 |
| Journal | Clinical and Translational Medicine |
| Published Year | 2024 |
| Human Genome ▶ | |
| Human Genome Version Description | GRCh37/hg19 |
| Human Genome RefSeq Accession | GCF_000001405.13 |
| Human Chromosome | chr20 |
| Cytogenetic Band | p11.21 |
| Human Strand | - |
| Human Integration Location Type | intronic |
| Hg19 Start | 25253825 |
| Hg19 End | 25253825 |
| Hg38 Start | 25273189 |
| Hg38 End | 25273189 |
| Junction Sequence | AGAAGGGGTTTCACCTTGTTGGTCAGGCTGGTTCTTACTTTCAAATGATTCGGAGAAAAATGAACTTACAGCGACAAAAAGGAGATTATTTGAAAGCGAAGACAGCGGGTATGGCAATACTGAAGTGGAAACTCAGCAGATGTT |
| Target Gene ▶ | |
| Target Gene | PYGB |
| Nearby Gene | - |
| Distance | - |
| Virus Information ▶ | |
| Virus Name | Human Papillomavirus |
| Virus Subtype Name | HPV16 |
| Virus Genome Accession | AF534061 |
| TaxonomyID | 10566 |
| Virus Abbreviation | HPV |
| Virus Genome | Human papillomavirus type 16 East Asian type, complete genome |
| Virus Genome Length | 7905 bp |
| Virus Breakpoint1 | 1228 |
| Virus Breakpoint2 | - |
| Virus Gene Name | HpV16gp3_E1 |
| Virus Region Type | - |
| Integrated Virus Sequence | - |
| ViMIC ID | - |
| Predicted VIS Effect ▶ | |
| Gene Id | ENSG00000100994.13 |
| Gene Name | PYGB |
| Region | intron |
| Impact | intronic_insertion |
| Transcript | Transcript 1: ENST00000944638.1, Transcript 2: ENST00000896648.1, Transcript 3: ENST00000896649.1, Transcript 4: ENST00000944639.1, Transcript 5: ENST00000944640.1, Transcript 6: ENST00000896656.1, Transcript 7: ENST00000896650.1, Transcript 8: ENST00000896651.1, Transcript 9: ENST00000944641.1, Transcript 10: ENST00000923184.1, Transcript 11: ENST00000923185.1, Transcript 12: ENST00000944642.1, Transcript 13: ENST00000216962.9, Transcript 14: ENST00000896652.1, Transcript 15: ENST00000944643.1, Transcript 16: ENST00000944646.1, Transcript 17: ENST00000944644.1, Transcript 18: ENST00000944645.1, Transcript 19: ENST00000896653.1, Transcript 20: ENST00000896654.1, Transcript 21: ENST00000896655.1 |
| SpliceAI Score | |
| Delta Scores | Acceptor Gain: 0.020 | Acceptor Loss: 0.000 | Donor Gain: 0.040 | Donor Loss: 0.010 |
| Delta Score Max | 0.040 |
| Delta Position at Max | 402 |
| Delta Score Flag | LOW |
| Gene | PYGB |
| AlphaGenome Analysis | |
| Window | chr20:25207653-25338725 |
| RNA-seq Change (±2kb) | Mean: 0.0045388792641460896 | Peak: 18.24615478515625 |
| ATAC Change (±2kb) | Mean: -0.0032245537731796503 | Peak: 11.111328125 |
| Interpretation | RNA-seq: minimal change 2.9% | Splice sites: no signal in region (REF≈0, ALT≈0) | ATAC: minimal change -6.9% |
| Visualization | |
Center for Precision Health
McWilliams School of Biomedical Informatics at UTHealth Houston
7000 Fannin Street, Suite 600, Houston, TX 77030
Email: Zhongming Zhao, Ph.D