| Basic Information ▶ | |
| VISDB ID | TVIS20056211 |
|---|---|
| Fusion Name | HPV-GRIK1 integration |
| Validated | No |
| Curated Way | Curated |
| Method | High-throughput Viral Integration Detection method |
| Wet Assay | Yes |
| Sample ID | - |
| Sample Name | S112 |
| Sample Type | Tumor |
| Age | 57 = 59; >57 = 50 |
| Gender | - |
| Disease Information ▶ | |
| Disease Name | Oropharyngeal squamous cell carcinoma |
| Disease Abbreviation | OPSCC |
| Cancer | Yes |
| Literature ▶ | |
| PubMed ID | 38279874 |
| Journal | Clinical and Translational Medicine |
| Published Year | 2024 |
| Human Genome ▶ | |
| Human Genome Version Description | GRCh37/hg19 |
| Human Genome RefSeq Accession | GCF_000001405.13 |
| Human Chromosome | chr21 |
| Cytogenetic Band | q21.3 |
| Human Strand | + |
| Human Integration Location Type | intronic |
| Hg19 Start | 30933373 |
| Hg19 End | 30933373 |
| Hg38 Start | 29561052 |
| Hg38 End | 29561052 |
| Junction Sequence | ATGGGAGAAAATATTCGCAGGGAGAAACTACATGACAGGGAATCAATAACCAGAATATATAAGGAACTCAAACAACTCAATAGCAAAACACAAATAATCTGAGTTTTAAATGGGCAGACACACAAAAGCACACAAAAGCAAAGCAAAAAGCACGCCAGTAATGTTGTGGATGCAGTATCAAGAT |
| Target Gene ▶ | |
| Target Gene | GRIK1, BACH1 |
| Nearby Gene | - |
| Distance | - |
| Virus Information ▶ | |
| Virus Name | Human Papillomavirus |
| Virus Subtype Name | HPV16 |
| Virus Genome Accession | AF534061 |
| TaxonomyID | 10566 |
| Virus Abbreviation | HPV |
| Virus Genome | Human papillomavirus type 16 East Asian type, complete genome |
| Virus Genome Length | 7905 bp |
| Virus Breakpoint1 | 3927 |
| Virus Breakpoint2 | - |
| Virus Gene Name | HpV16gp6_E5 |
| Virus Region Type | - |
| Integrated Virus Sequence | - |
| ViMIC ID | - |
| Predicted VIS Effect ▶ | |
| Transcript | Transcript 1: ENST00000422809.5, Transcript 2: ENST00000468059.1, Transcript 3: ENST00000389125.7, Transcript 4: ENST00000399913.5, Transcript 5: ENST00000327783.9, Transcript 6: ENST00000399914.5, Transcript 7: ENST00000389124.6, Transcript 8: ENST00000399907.6, Transcript 9: ENST00000399909.5, Transcript 10: ENST00000743232.1 |
| Transcript 1 Gene Id | ENSG00000156273.17 |
| Transcript 1 Gene Name | BACH1 |
| Transcript 1 Region | intron |
| Transcript 1 Impact | intronic_insertion |
| Transcript 2 Gene Id | ENSG00000156273.17 |
| Transcript 2 Gene Name | BACH1 |
| Transcript 2 Region | intron |
| Transcript 2 Impact | intronic_insertion |
| Transcript 3 Gene Id | ENSG00000171189.18 |
| Transcript 3 Gene Name | GRIK1 |
| Transcript 3 Region | intron |
| Transcript 3 Impact | intronic_insertion |
| Transcript 4 Gene Id | ENSG00000171189.18 |
| Transcript 4 Gene Name | GRIK1 |
| Transcript 4 Region | intron |
| Transcript 4 Impact | intronic_insertion |
| Transcript 5 Gene Id | ENSG00000171189.18 |
| Transcript 5 Gene Name | GRIK1 |
| Transcript 5 Region | intron |
| Transcript 5 Impact | intronic_insertion |
| Transcript 6 Gene Id | ENSG00000171189.18 |
| Transcript 6 Gene Name | GRIK1 |
| Transcript 6 Region | intron |
| Transcript 6 Impact | intronic_insertion |
| Transcript 7 Gene Id | ENSG00000171189.18 |
| Transcript 7 Gene Name | GRIK1 |
| Transcript 7 Region | intron |
| Transcript 7 Impact | intronic_insertion |
| Transcript 8 Gene Id | ENSG00000171189.18 |
| Transcript 8 Gene Name | GRIK1 |
| Transcript 8 Region | intron |
| Transcript 8 Impact | intronic_insertion |
| Transcript 9 Gene Id | ENSG00000171189.18 |
| Transcript 9 Gene Name | GRIK1 |
| Transcript 9 Region | intron |
| Transcript 9 Impact | intronic_insertion |
| Transcript 10 Gene Id | ENSG00000296862.1 |
| Transcript 10 Gene Name | ENSG00000296862 |
| Transcript 10 Region | promoter |
| Transcript 10 Impact | promoter_insertion |
| SpliceAI Score | |
| Delta Scores | Acceptor Gain: 0.000 | Acceptor Loss: 0.010 | Donor Gain: 0.010 | Donor Loss: 0.010 |
| Delta Score Max | 0.010 |
| Delta Position at Max | -2131 |
| Delta Score Flag | LOW |
| Gene | GRIK1 |
| AlphaGenome Analysis | |
| Window | chr21:29495516-29626588 |
| RNA-seq Change (±2kb) | Mean: -6.901109736645594e-05 | Peak: 1.25390625 |
| ATAC Change (±2kb) | Mean: 0.000299263367196545 | Peak: 1.25 |
| Interpretation | RNA-seq: no signal in region (REF≈0, ALT≈0) | Splice sites: no signal in region (REF≈0, ALT≈0) | ATAC: minimal change 1.5% |
| Visualization | |
Center for Precision Health
McWilliams School of Biomedical Informatics at UTHealth Houston
7000 Fannin Street, Suite 600, Houston, TX 77030
Email: Zhongming Zhao, Ph.D