| Basic Information ▶ | |
| VISDB ID | TVIS20057253 |
|---|---|
| Fusion Name | HPV-ENSG00000244327 integration |
| Validated | No |
| Curated Way | Curated |
| Method | High-throughput Viral Integration Detection method |
| Wet Assay | Yes |
| Sample ID | - |
| Sample Name | S106 |
| Sample Type | Tumor |
| Age | 57 = 59; >57 = 50 |
| Gender | - |
| Disease Information ▶ | |
| Disease Name | Oropharyngeal squamous cell carcinoma |
| Disease Abbreviation | OPSCC |
| Cancer | Yes |
| Literature ▶ | |
| PubMed ID | 38279874 |
| Journal | Clinical and Translational Medicine |
| Published Year | 2024 |
| Human Genome ▶ | |
| Human Genome Version Description | GRCh37/hg19 |
| Human Genome RefSeq Accession | GCF_000001405.13 |
| Human Chromosome | chr3 |
| Cytogenetic Band | q23 |
| Human Strand | + |
| Human Integration Location Type | intronic |
| Hg19 Start | 142190271 |
| Hg19 End | 142190271 |
| Hg38 Start | 142471429 |
| Hg38 End | 142471429 |
| Junction Sequence | ATAGATTGGAAGACAGGTTGGAATAGACTGGGTAGAATGAAGCACAGAGAGACAAAAGGATGGAAAATATGTAAGATAGGGTTAGATATACAGGGGATTCAGTAGTTGCACATAGTGCAGTGTAAAAAACAATGGAATGGTTGGCAAGCAGTGCAGGTCAGGAAAACAG |
| Target Gene ▶ | |
| Target Gene | ENSG00000244327, ENSG00000295506, ATR |
| Nearby Gene | - |
| Distance | - |
| Virus Information ▶ | |
| Virus Name | Human Papillomavirus |
| Virus Subtype Name | HPV16 |
| Virus Genome Accession | AF125673 |
| TaxonomyID | 10566 |
| Virus Abbreviation | HPV |
| Virus Genome | Human papillomavirus type 16 isolate 16W12E, complete genome |
| Virus Genome Length | 7904 bp |
| Virus Breakpoint1 | 7635 |
| Virus Breakpoint2 | - |
| Virus Gene Name | HpV16gp8_L1//downstream |
| Virus Region Type | - |
| Integrated Virus Sequence | - |
| ViMIC ID | - |
| Predicted VIS Effect ▶ | |
| Region | intron |
| Impact | intronic_insertion |
| Transcript | Transcript 1: ENST00000730510.1, Transcript 2: ENST00000656590.1, Transcript 3: ENST00000350721.9, Transcript 4: ENST00000936442.1, Transcript 5: ENST00000936443.1, Transcript 6: ENST00000513291.2, Transcript 7: ENST00000892891.1, Transcript 8: ENST00000654170.1, Transcript 9: ENST00000666447.1, Transcript 10: ENST00000666943.1, Transcript 11: ENST00000665483.1, Transcript 12: ENST00000661310.1, Transcript 13: ENST00000460977.1 |
| Transcript 1 Gene Id | ENSG00000295506.1 |
| Transcript 1 Gene Name | ENSG00000295506 |
| Transcript 2 Gene Id | ENSG00000175054.17 |
| Transcript 2 Gene Name | ATR |
| Transcript 3 Gene Id | ENSG00000175054.17 |
| Transcript 3 Gene Name | ATR |
| Transcript 4 Gene Id | ENSG00000175054.17 |
| Transcript 4 Gene Name | ATR |
| Transcript 5 Gene Id | ENSG00000175054.17 |
| Transcript 5 Gene Name | ATR |
| Transcript 6 Gene Id | ENSG00000175054.17 |
| Transcript 6 Gene Name | ATR |
| Transcript 7 Gene Id | ENSG00000175054.17 |
| Transcript 7 Gene Name | ATR |
| Transcript 8 Gene Id | ENSG00000175054.17 |
| Transcript 8 Gene Name | ATR |
| Transcript 9 Gene Id | ENSG00000175054.17 |
| Transcript 9 Gene Name | ATR |
| Transcript 10 Gene Id | ENSG00000175054.17 |
| Transcript 10 Gene Name | ATR |
| Transcript 11 Gene Id | ENSG00000175054.17 |
| Transcript 11 Gene Name | ATR |
| Transcript 12 Gene Id | ENSG00000175054.17 |
| Transcript 12 Gene Name | ATR |
| Transcript 13 Gene Id | ENSG00000244327.1 |
| Transcript 13 Gene Name | ENSG00000244327 |
| SpliceAI Score | |
| Delta Scores | Acceptor Gain: 0.010 | Acceptor Loss: 0.020 | Donor Gain: 0.010 | Donor Loss: 0.020 |
| Delta Score Max | 0.020 |
| Delta Position at Max | -1064 |
| Delta Score Flag | LOW |
| Gene | ATR |
| AlphaGenome Analysis | |
| Chromosome | chr3 |
Center for Precision Health
McWilliams School of Biomedical Informatics at UTHealth Houston
7000 Fannin Street, Suite 600, Houston, TX 77030
Email: Zhongming Zhao, Ph.D