| Basic Information ▶ | |
| VISDB ID | TVIS20057290 |
|---|---|
| Fusion Name | HPV-ITGB5 integration |
| Validated | No |
| Curated Way | Curated |
| Method | High-throughput Viral Integration Detection method |
| Wet Assay | Yes |
| Sample ID | - |
| Sample Name | S106 |
| Sample Type | Tumor |
| Age | 57 = 59; >57 = 50 |
| Gender | - |
| Disease Information ▶ | |
| Disease Name | Oropharyngeal squamous cell carcinoma |
| Disease Abbreviation | OPSCC |
| Cancer | Yes |
| Literature ▶ | |
| PubMed ID | 38279874 |
| Journal | Clinical and Translational Medicine |
| Published Year | 2024 |
| Human Genome ▶ | |
| Human Genome Version Description | GRCh37/hg19 |
| Human Genome RefSeq Accession | GCF_000001405.13 |
| Human Chromosome | chr3 |
| Cytogenetic Band | q21.2 |
| Human Strand | + |
| Human Integration Location Type | intronic |
| Hg19 Start | 124585944 |
| Hg19 End | 124585944 |
| Hg38 Start | 124867097 |
| Hg38 End | 124867097 |
| Junction Sequence | ATCCTAATGGAACTTTCTGGCTGAGTTACTGGTGAATAAACTTCATCCAAGCCACCTTTCAGCATCCCCTGTTTTTTTTTCCACTACAGCCTCTACATAAAACCATCCATTACATCCCGTACCC |
| Target Gene ▶ | |
| Target Gene | ITGB5 |
| Nearby Gene | - |
| Distance | - |
| Virus Information ▶ | |
| Virus Name | Human Papillomavirus |
| Virus Subtype Name | HPV16 |
| Virus Genome Accession | AF125673 |
| TaxonomyID | 10566 |
| Virus Abbreviation | HPV |
| Virus Genome | Human papillomavirus type 16 isolate 16W12E, complete genome |
| Virus Genome Length | 7904 bp |
| Virus Breakpoint1 | 959 |
| Virus Breakpoint2 | - |
| Virus Gene Name | HpV16gp3_E1 |
| Virus Region Type | - |
| Integrated Virus Sequence | - |
| ViMIC ID | - |
| Predicted VIS Effect ▶ | |
| Gene Id | ENSG00000082781.13 |
| Gene Name | ITGB5 |
| Region | intron |
| Impact | intronic_insertion |
| Transcript | Transcript 1: ENST00000296181.9, Transcript 2: ENST00000935896.1, Transcript 3: ENST00000935895.1, Transcript 4: ENST00000905025.1, Transcript 5: ENST00000935897.1, Transcript 6: ENST00000935909.1, Transcript 7: ENST00000935905.1, Transcript 8: ENST00000935904.1, Transcript 9: ENST00000935900.1, Transcript 10: ENST00000935899.1, Transcript 11: ENST00000935898.1, Transcript 12: ENST00000965613.1, Transcript 13: ENST00000935903.1, Transcript 14: ENST00000935902.1, Transcript 15: ENST00000965614.1, Transcript 16: ENST00000935907.1, Transcript 17: ENST00000965612.1, Transcript 18: ENST00000935901.1, Transcript 19: ENST00000935906.1, Transcript 20: ENST00000905026.1, Transcript 21: ENST00000935908.1, Transcript 22: ENST00000965617.1, Transcript 23: ENST00000965616.1, Transcript 24: ENST00000965615.1, Transcript 25: ENST00000935910.1, Transcript 26: ENST00000465464.5, Transcript 27: ENST00000608657.5, Transcript 28: ENST00000483168.5, Transcript 29: ENST00000608107.1 |
| SpliceAI Score | |
| Delta Scores | Acceptor Gain: 0.000 | Acceptor Loss: 0.000 | Donor Gain: 0.000 | Donor Loss: 0.000 |
| Delta Score Max | 0.000 |
| Delta Position at Max | -1292 |
| Delta Score Flag | LOW |
| Gene | ITGB5 |
| AlphaGenome Analysis | |
| Window | chr3:124801561-124932633 |
| RNA-seq Change (±2kb) | Mean: 2.177399983338546e-05 | Peak: 0.126708984375 |
| ATAC Change (±2kb) | Mean: -0.00019423839694354683 | Peak: 2.1093263626098633 |
| Interpretation | RNA-seq: no signal in region (REF≈0, ALT≈0) | Splice sites: no signal in region (REF≈0, ALT≈0) | ATAC: minimal change -0.7% |
| Visualization | |
Center for Precision Health
McWilliams School of Biomedical Informatics at UTHealth Houston
7000 Fannin Street, Suite 600, Houston, TX 77030
Email: Zhongming Zhao, Ph.D