| Basic Information ▶ | |
| VISDB ID | TVIS20057639 |
|---|---|
| Fusion Name | HPV-ENSG00000283563 integration |
| Validated | No |
| Curated Way | Curated |
| Method | High-throughput Viral Integration Detection method |
| Wet Assay | Yes |
| Sample ID | - |
| Sample Name | S102 |
| Sample Type | Tumor |
| Age | 57 = 59; >57 = 50 |
| Gender | - |
| Disease Information ▶ | |
| Disease Name | Oropharyngeal squamous cell carcinoma |
| Disease Abbreviation | OPSCC |
| Cancer | Yes |
| Literature ▶ | |
| PubMed ID | 38279874 |
| Journal | Clinical and Translational Medicine |
| Published Year | 2024 |
| Human Genome ▶ | |
| Human Genome Version Description | GRCh37/hg19 |
| Human Genome RefSeq Accession | GCF_000001405.13 |
| Human Chromosome | chr3 |
| Cytogenetic Band | p24.1 |
| Human Strand | + |
| Human Integration Location Type | intronic |
| Hg19 Start | 29490760 |
| Hg19 End | 29490760 |
| Hg38 Start | 29449269 |
| Hg38 End | 29449269 |
| Junction Sequence | AAATGGAGTGGAGTGAATTAGGGTGGGCAGTTGAGAACTTGGAGAACATTTGAGAAGAAAGCTGGGCCATGAGACTGAAACACCATGTAGTCAGTATAGTGGTGGAAGTGGGGGTGGTTGCAGTCAGTACAGTAGTGGAAGTGGGGGAGAGGGTGTTAGTGAAAGACACACTATATGCCAAACACCACTTACAAATATTTACAGC |
| Target Gene ▶ | |
| Target Gene | ENSG00000283563, RBMS3 |
| Nearby Gene | - |
| Distance | - |
| Virus Information ▶ | |
| Virus Name | Human Papillomavirus |
| Virus Subtype Name | HPV16 |
| Virus Genome Accession | HQ644236 |
| TaxonomyID | 10566 |
| Virus Abbreviation | HPV |
| Virus Genome | Human papillomavirus type 16 isolate AS411, complete genome |
| Virus Genome Length | 7905bp |
| Virus Breakpoint1 | 1312 |
| Virus Breakpoint2 | - |
| Virus Gene Name | HpV16gp3_E1 |
| Virus Region Type | - |
| Integrated Virus Sequence | - |
| ViMIC ID | - |
| Predicted VIS Effect ▶ | |
| Region | intron |
| Impact | intronic_insertion |
| Transcript | Transcript 1: ENST00000635992.1, Transcript 2: ENST00000636680.2, Transcript 3: ENST00000637842.1, Transcript 4: ENST00000914497.1, Transcript 5: ENST00000874344.1, Transcript 6: ENST00000434693.6, Transcript 7: ENST00000874346.1, Transcript 8: ENST00000874343.1, Transcript 9: ENST00000874345.1, Transcript 10: ENST00000963907.1, Transcript 11: ENST00000874348.1, Transcript 12: ENST00000963910.1, Transcript 13: ENST00000963908.1, Transcript 14: ENST00000963906.1, Transcript 15: ENST00000963905.1, Transcript 16: ENST00000874347.1, Transcript 17: ENST00000383767.7, Transcript 18: ENST00000963909.1, Transcript 19: ENST00000963913.1, Transcript 20: ENST00000963911.1, Transcript 21: ENST00000963912.1, Transcript 22: ENST00000445033.5, Transcript 23: ENST00000273139.13, Transcript 24: ENST00000383766.6, Transcript 25: ENST00000452462.5, Transcript 26: ENST00000456853.1, Transcript 27: ENST00000497205.1 |
| Transcript 1 Gene Id | ENSG00000283563.1 |
| Transcript 1 Gene Name | ENSG00000283563 |
| Transcript 2 Gene Id | ENSG00000144642.23 |
| Transcript 2 Gene Name | RBMS3 |
| Transcript 3 Gene Id | ENSG00000144642.23 |
| Transcript 3 Gene Name | RBMS3 |
| Transcript 4 Gene Id | ENSG00000144642.23 |
| Transcript 4 Gene Name | RBMS3 |
| Transcript 5 Gene Id | ENSG00000144642.23 |
| Transcript 5 Gene Name | RBMS3 |
| Transcript 6 Gene Id | ENSG00000144642.23 |
| Transcript 6 Gene Name | RBMS3 |
| Transcript 7 Gene Id | ENSG00000144642.23 |
| Transcript 7 Gene Name | RBMS3 |
| Transcript 8 Gene Id | ENSG00000144642.23 |
| Transcript 8 Gene Name | RBMS3 |
| Transcript 9 Gene Id | ENSG00000144642.23 |
| Transcript 9 Gene Name | RBMS3 |
| Transcript 10 Gene Id | ENSG00000144642.23 |
| Transcript 10 Gene Name | RBMS3 |
| Transcript 11 Gene Id | ENSG00000144642.23 |
| Transcript 11 Gene Name | RBMS3 |
| Transcript 12 Gene Id | ENSG00000144642.23 |
| Transcript 12 Gene Name | RBMS3 |
| Transcript 13 Gene Id | ENSG00000144642.23 |
| Transcript 13 Gene Name | RBMS3 |
| Transcript 14 Gene Id | ENSG00000144642.23 |
| Transcript 14 Gene Name | RBMS3 |
| Transcript 15 Gene Id | ENSG00000144642.23 |
| Transcript 15 Gene Name | RBMS3 |
| Transcript 16 Gene Id | ENSG00000144642.23 |
| Transcript 16 Gene Name | RBMS3 |
| Transcript 17 Gene Id | ENSG00000144642.23 |
| Transcript 17 Gene Name | RBMS3 |
| Transcript 18 Gene Id | ENSG00000144642.23 |
| Transcript 18 Gene Name | RBMS3 |
| Transcript 19 Gene Id | ENSG00000144642.23 |
| Transcript 19 Gene Name | RBMS3 |
| Transcript 20 Gene Id | ENSG00000144642.23 |
| Transcript 20 Gene Name | RBMS3 |
| Transcript 21 Gene Id | ENSG00000144642.23 |
| Transcript 21 Gene Name | RBMS3 |
| Transcript 22 Gene Id | ENSG00000144642.23 |
| Transcript 22 Gene Name | RBMS3 |
| Transcript 23 Gene Id | ENSG00000144642.23 |
| Transcript 23 Gene Name | RBMS3 |
| Transcript 24 Gene Id | ENSG00000144642.23 |
| Transcript 24 Gene Name | RBMS3 |
| Transcript 25 Gene Id | ENSG00000144642.23 |
| Transcript 25 Gene Name | RBMS3 |
| Transcript 26 Gene Id | ENSG00000144642.23 |
| Transcript 26 Gene Name | RBMS3 |
| Transcript 27 Gene Id | ENSG00000144642.23 |
| Transcript 27 Gene Name | RBMS3 |
| SpliceAI Score | |
| Delta Scores | Acceptor Gain: 0.000 | Acceptor Loss: 0.000 | Donor Gain: 0.000 | Donor Loss: 0.000 |
| Delta Score Max | 0.000 |
| Delta Position at Max | 2321 |
| Delta Score Flag | LOW |
| Gene | RBMS3 |
| AlphaGenome Analysis | |
| Window | chr3:29383733-29514805 |
| RNA-seq Change (±2kb) | Mean: 8.1376034358982e-05 | Peak: 0.27001953125 |
| ATAC Change (±2kb) | Mean: 0.0011477973312139511 | Peak: 1.506134033203125 |
| Interpretation | RNA-seq: no signal in region (REF≈0, ALT≈0) | Splice sites: no signal in region (REF≈0, ALT≈0) | ATAC: minimal change 4.7% |
| Visualization | |
Center for Precision Health
McWilliams School of Biomedical Informatics at UTHealth Houston
7000 Fannin Street, Suite 600, Houston, TX 77030
Email: Zhongming Zhao, Ph.D