| Basic Information ▶ | |
| VISDB ID | TVIS20059315 |
|---|---|
| Fusion Name | HPV-KIF2A integration |
| Validated | No |
| Curated Way | Curated |
| Method | High-throughput Viral Integration Detection method |
| Wet Assay | Yes |
| Sample ID | - |
| Sample Name | S094 |
| Sample Type | Tumor |
| Age | 57 = 59; >57 = 50 |
| Gender | - |
| Disease Information ▶ | |
| Disease Name | Oropharyngeal squamous cell carcinoma |
| Disease Abbreviation | OPSCC |
| Cancer | Yes |
| Literature ▶ | |
| PubMed ID | 38279874 |
| Journal | Clinical and Translational Medicine |
| Published Year | 2024 |
| Human Genome ▶ | |
| Human Genome Version Description | GRCh37/hg19 |
| Human Genome RefSeq Accession | GCF_000001405.13 |
| Human Chromosome | chr5 |
| Cytogenetic Band | q12.1 |
| Human Strand | + |
| Human Integration Location Type | exonic |
| Hg19 Start | 61669214 |
| Hg19 End | 61669214 |
| Hg38 Start | 62373387 |
| Hg38 End | 62373387 |
| Junction Sequence | ATCCAAATCTATGAGTCCTTCTTATCTTTGTGGAACTTCACCGCCTTGTGGAGCCTCAGCTCTGGGGGGTCATGTGCATTGTTCCTATGTACTACTGGTGGAATAGGCTGGCTCTGTTTCTGCCTGTGTTAAATAATCATTATCATTTACTATAAAATCTACCAAATCTTCACCTGTATCACTGTCATTTTCGTTCT |
| Target Gene ▶ | |
| Target Gene | KIF2A, ENSG00000288643, DIMT1 |
| Nearby Gene | - |
| Distance | - |
| Virus Information ▶ | |
| Virus Name | Human Papillomavirus |
| Virus Subtype Name | HPV16 |
| Virus Genome Accession | AF534061 |
| TaxonomyID | 10566 |
| Virus Abbreviation | HPV |
| Virus Genome | Human papillomavirus type 16 East Asian type, complete genome |
| Virus Genome Length | 7905 bp |
| Virus Breakpoint1 | 1058 |
| Virus Breakpoint2 | - |
| Virus Gene Name | HpV16gp3_E1 |
| Virus Region Type | - |
| Integrated Virus Sequence | - |
| ViMIC ID | - |
| Predicted VIS Effect ▶ | |
| Transcript | Transcript 1: ENST00000401507.7, Transcript 2: ENST00000908146.1, Transcript 3: ENST00000908144.1, Transcript 4: ENST00000407818.8, Transcript 5: ENST00000674632.1, Transcript 6: ENST00000674751.1, Transcript 7: ENST00000674916.1, Transcript 8: ENST00000676122.1, Transcript 9: ENST00000676413.1, Transcript 10: ENST00000908147.1, Transcript 11: ENST00000908145.1, Transcript 12: ENST00000908143.1, Transcript 13: ENST00000381103.7, Transcript 14: ENST00000908148.1, Transcript 15: ENST00000927778.1, Transcript 16: ENST00000927780.1, Transcript 17: ENST00000927777.1, Transcript 18: ENST00000927779.1, Transcript 19: ENST00000676271.1, Transcript 20: ENST00000908149.1, Transcript 21: ENST00000674733.1, Transcript 22: ENST00000506857.5, Transcript 23: ENST00000674752.1, Transcript 24: ENST00000512006.2, Transcript 25: ENST00000675534.1, Transcript 26: ENST00000675387.1, Transcript 27: ENST00000509663.2, Transcript 28: ENST00000651114.1 |
| Transcript 1 Gene Id | ENSG00000068796.20 |
| Transcript 1 Gene Name | KIF2A |
| Transcript 1 Region | intron |
| Transcript 1 Impact | intronic_insertion |
| Transcript 2 Gene Id | ENSG00000068796.20 |
| Transcript 2 Gene Name | KIF2A |
| Transcript 2 Region | intron |
| Transcript 2 Impact | intronic_insertion |
| Transcript 3 Gene Id | ENSG00000068796.20 |
| Transcript 3 Gene Name | KIF2A |
| Transcript 3 Region | intron |
| Transcript 3 Impact | intronic_insertion |
| Transcript 4 Gene Id | ENSG00000068796.20 |
| Transcript 4 Gene Name | KIF2A |
| Transcript 4 Region | intron |
| Transcript 4 Impact | intronic_insertion |
| Transcript 5 Gene Id | ENSG00000068796.20 |
| Transcript 5 Gene Name | KIF2A |
| Transcript 5 Region | intron |
| Transcript 5 Impact | intronic_insertion |
| Transcript 6 Gene Id | ENSG00000068796.20 |
| Transcript 6 Gene Name | KIF2A |
| Transcript 6 Region | intron |
| Transcript 6 Impact | intronic_insertion |
| Transcript 7 Gene Id | ENSG00000068796.20 |
| Transcript 7 Gene Name | KIF2A |
| Transcript 7 Region | intron |
| Transcript 7 Impact | intronic_insertion |
| Transcript 8 Gene Id | ENSG00000068796.20 |
| Transcript 8 Gene Name | KIF2A |
| Transcript 8 Region | intron |
| Transcript 8 Impact | intronic_insertion |
| Transcript 9 Gene Id | ENSG00000068796.20 |
| Transcript 9 Gene Name | KIF2A |
| Transcript 9 Region | intron |
| Transcript 9 Impact | intronic_insertion |
| Transcript 10 Gene Id | ENSG00000068796.20 |
| Transcript 10 Gene Name | KIF2A |
| Transcript 10 Region | intron |
| Transcript 10 Impact | intronic_insertion |
| Transcript 11 Gene Id | ENSG00000068796.20 |
| Transcript 11 Gene Name | KIF2A |
| Transcript 11 Region | intron |
| Transcript 11 Impact | intronic_insertion |
| Transcript 12 Gene Id | ENSG00000068796.20 |
| Transcript 12 Gene Name | KIF2A |
| Transcript 12 Region | intron |
| Transcript 12 Impact | intronic_insertion |
| Transcript 13 Gene Id | ENSG00000068796.20 |
| Transcript 13 Gene Name | KIF2A |
| Transcript 13 Region | intron |
| Transcript 13 Impact | intronic_insertion |
| Transcript 14 Gene Id | ENSG00000068796.20 |
| Transcript 14 Gene Name | KIF2A |
| Transcript 14 Region | intron |
| Transcript 14 Impact | intronic_insertion |
| Transcript 15 Gene Id | ENSG00000068796.20 |
| Transcript 15 Gene Name | KIF2A |
| Transcript 15 Region | intron |
| Transcript 15 Impact | intronic_insertion |
| Transcript 16 Gene Id | ENSG00000068796.20 |
| Transcript 16 Gene Name | KIF2A |
| Transcript 16 Region | intron |
| Transcript 16 Impact | intronic_insertion |
| Transcript 17 Gene Id | ENSG00000068796.20 |
| Transcript 17 Gene Name | KIF2A |
| Transcript 17 Region | intron |
| Transcript 17 Impact | intronic_insertion |
| Transcript 18 Gene Id | ENSG00000068796.20 |
| Transcript 18 Gene Name | KIF2A |
| Transcript 18 Region | intron |
| Transcript 18 Impact | intronic_insertion |
| Transcript 19 Gene Id | ENSG00000068796.20 |
| Transcript 19 Gene Name | KIF2A |
| Transcript 19 Region | intron |
| Transcript 19 Impact | intronic_insertion |
| Transcript 20 Gene Id | ENSG00000068796.20 |
| Transcript 20 Gene Name | KIF2A |
| Transcript 20 Region | intron |
| Transcript 20 Impact | intronic_insertion |
| Transcript 21 Gene Id | ENSG00000068796.20 |
| Transcript 21 Gene Name | KIF2A |
| Transcript 21 Region | intron |
| Transcript 21 Impact | intronic_insertion |
| Transcript 22 Gene Id | ENSG00000068796.20 |
| Transcript 22 Gene Name | KIF2A |
| Transcript 22 Region | intron |
| Transcript 22 Impact | intronic_insertion |
| Transcript 23 Gene Id | ENSG00000068796.20 |
| Transcript 23 Gene Name | KIF2A |
| Transcript 23 Region | intron |
| Transcript 23 Impact | intronic_insertion |
| Transcript 24 Gene Id | ENSG00000068796.20 |
| Transcript 24 Gene Name | KIF2A |
| Transcript 24 Region | intron |
| Transcript 24 Impact | intronic_insertion |
| Transcript 25 Gene Id | ENSG00000068796.20 |
| Transcript 25 Gene Name | KIF2A |
| Transcript 25 Region | exon_non_coding |
| Transcript 25 Impact | noncoding_exon_insertion |
| Transcript 26 Gene Id | ENSG00000068796.20 |
| Transcript 26 Gene Name | KIF2A |
| Transcript 26 Region | intron |
| Transcript 26 Impact | intronic_insertion |
| Transcript 27 Gene Id | ENSG00000288643.1 |
| Transcript 27 Gene Name | ENSG00000288643 |
| Transcript 27 Region | intron |
| Transcript 27 Impact | intronic_insertion |
| Transcript 28 Gene Id | ENSG00000086189.12 |
| Transcript 28 Gene Name | DIMT1 |
| Transcript 28 Region | intron |
| Transcript 28 Impact | intronic_insertion |
| SpliceAI Score | |
| Delta Scores | Acceptor Gain: 0.020 | Acceptor Loss: 0.010 | Donor Gain: 0.020 | Donor Loss: 0.010 |
| Delta Score Max | 0.020 |
| Delta Position at Max | 300 |
| Delta Score Flag | LOW |
| Gene | KIF2A |
| Altered Protein (FASTA) | |
| AlphaGenome Analysis | |
| Window | chr5:62307851-62438923 |
| RNA-seq Change (±2kb) | Mean: 0.0015549854142591357 | Peak: 3.0303993225097656 |
| ATAC Change (±2kb) | Mean: -7.391158578684554e-05 | Peak: 1.5703125 |
| Interpretation | RNA-seq: minimal change 4.6% | Splice sites: no signal in region (REF≈0, ALT≈0) | ATAC: minimal change -0.3% |
| Visualization | |
Center for Precision Health
McWilliams School of Biomedical Informatics at UTHealth Houston
7000 Fannin Street, Suite 600, Houston, TX 77030
Email: Zhongming Zhao, Ph.D