| Basic Information ▶ | |
| VISDB ID | TVIS20060054 |
|---|---|
| Fusion Name | HPV-ZFYVE16 integration |
| Validated | No |
| Curated Way | Curated |
| Method | High-throughput Viral Integration Detection method |
| Wet Assay | Yes |
| Sample ID | - |
| Sample Name | S102 |
| Sample Type | Tumor |
| Age | 57 = 59; >57 = 50 |
| Gender | - |
| Disease Information ▶ | |
| Disease Name | Oropharyngeal squamous cell carcinoma |
| Disease Abbreviation | OPSCC |
| Cancer | Yes |
| Literature ▶ | |
| PubMed ID | 38279874 |
| Journal | Clinical and Translational Medicine |
| Published Year | 2024 |
| Human Genome ▶ | |
| Human Genome Version Description | GRCh37/hg19 |
| Human Genome RefSeq Accession | GCF_000001405.13 |
| Human Chromosome | chr5 |
| Cytogenetic Band | q14.1 |
| Human Strand | - |
| Human Integration Location Type | intronic |
| Hg19 Start | 79759037 |
| Hg19 End | 79759037 |
| Hg38 Start | 80463218 |
| Hg38 End | 80463218 |
| Junction Sequence | ATTCCCAAATTTTGCGTCTGTAGTTATTATTTCATTATATGGTTGTTGGGGAATGGTTGTGTTACTATTAGTAAGATATAAATGTGGAAAAAATAGAGAAACAATTGAAAAATTGCTGTCTAAACTATTATGTGTGTCTCCAATGTGTATGATGATAGAGCCTCCAAAATTGCGTAGTACAGAC |
| Target Gene ▶ | |
| Target Gene | ZFYVE16, FAM151B-DT |
| Nearby Gene | - |
| Distance | - |
| Virus Information ▶ | |
| Virus Name | Human Papillomavirus |
| Virus Subtype Name | HPV16 |
| Virus Genome Accession | HQ644236 |
| TaxonomyID | 10566 |
| Virus Abbreviation | HPV |
| Virus Genome | Human papillomavirus type 16 isolate AS411, complete genome |
| Virus Genome Length | 7905bp |
| Virus Breakpoint1 | 1674 |
| Virus Breakpoint2 | - |
| Virus Gene Name | HpV16gp3_E1 |
| Virus Region Type | - |
| Integrated Virus Sequence | - |
| ViMIC ID | - |
| Predicted VIS Effect ▶ | |
| Region | intron |
| Impact | intronic_insertion |
| Transcript | Transcript 1: ENST00000967667.1, Transcript 2: ENST00000967668.1, Transcript 3: ENST00000868097.1, Transcript 4: ENST00000967670.1, Transcript 5: ENST00000338008.9, Transcript 6: ENST00000510158.5, Transcript 7: ENST00000967669.1, Transcript 8: ENST00000868098.1, Transcript 9: ENST00000505560.5, Transcript 10: ENST00000967671.1, Transcript 11: ENST00000868099.1, Transcript 12: ENST00000511829.5, Transcript 13: ENST00000512907.5, Transcript 14: ENST00000513789.1, Transcript 15: ENST00000666568.1 |
| Transcript 1 Gene Id | ENSG00000039319.18 |
| Transcript 1 Gene Name | ZFYVE16 |
| Transcript 2 Gene Id | ENSG00000039319.18 |
| Transcript 2 Gene Name | ZFYVE16 |
| Transcript 3 Gene Id | ENSG00000039319.18 |
| Transcript 3 Gene Name | ZFYVE16 |
| Transcript 4 Gene Id | ENSG00000039319.18 |
| Transcript 4 Gene Name | ZFYVE16 |
| Transcript 5 Gene Id | ENSG00000039319.18 |
| Transcript 5 Gene Name | ZFYVE16 |
| Transcript 6 Gene Id | ENSG00000039319.18 |
| Transcript 6 Gene Name | ZFYVE16 |
| Transcript 7 Gene Id | ENSG00000039319.18 |
| Transcript 7 Gene Name | ZFYVE16 |
| Transcript 8 Gene Id | ENSG00000039319.18 |
| Transcript 8 Gene Name | ZFYVE16 |
| Transcript 9 Gene Id | ENSG00000039319.18 |
| Transcript 9 Gene Name | ZFYVE16 |
| Transcript 10 Gene Id | ENSG00000039319.18 |
| Transcript 10 Gene Name | ZFYVE16 |
| Transcript 11 Gene Id | ENSG00000039319.18 |
| Transcript 11 Gene Name | ZFYVE16 |
| Transcript 12 Gene Id | ENSG00000039319.18 |
| Transcript 12 Gene Name | ZFYVE16 |
| Transcript 13 Gene Id | ENSG00000039319.18 |
| Transcript 13 Gene Name | ZFYVE16 |
| Transcript 14 Gene Id | ENSG00000039319.18 |
| Transcript 14 Gene Name | ZFYVE16 |
| Transcript 15 Gene Id | ENSG00000249042.7 |
| Transcript 15 Gene Name | FAM151B-DT |
| SpliceAI Score | |
| Delta Scores | Acceptor Gain: 0.000 | Acceptor Loss: 0.000 | Donor Gain: 0.000 | Donor Loss: 0.000 |
| Delta Score Max | 0.000 |
| Delta Position at Max | -279 |
| Delta Score Flag | LOW |
| Gene | ZFYVE16 |
| AlphaGenome Analysis | |
| Window | chr5:80397682-80528754 |
| RNA-seq Change (±2kb) | Mean: 0.0010729995556175709 | Peak: 0.146484375 |
| ATAC Change (±2kb) | Mean: 0.0005685610813088715 | Peak: 1.0087890625 |
| Interpretation | RNA-seq: minimal change 7.9% | Splice sites: no signal in region (REF≈0, ALT≈0) | ATAC: minimal change 3.8% |
| Visualization | |
Center for Precision Health
McWilliams School of Biomedical Informatics at UTHealth Houston
7000 Fannin Street, Suite 600, Houston, TX 77030
Email: Zhongming Zhao, Ph.D