| Basic Information ▶ | |
| VISDB ID | TVIS20060153 |
|---|---|
| Fusion Name | HPV-LINC01331 integration |
| Validated | No |
| Curated Way | Curated |
| Method | High-throughput Viral Integration Detection method |
| Wet Assay | Yes |
| Sample ID | - |
| Sample Name | S110 |
| Sample Type | Tumor |
| Age | 57 = 59; >57 = 50 |
| Gender | - |
| Disease Information ▶ | |
| Disease Name | Oropharyngeal squamous cell carcinoma |
| Disease Abbreviation | OPSCC |
| Cancer | Yes |
| Literature ▶ | |
| PubMed ID | 38279874 |
| Journal | Clinical and Translational Medicine |
| Published Year | 2024 |
| Human Genome ▶ | |
| Human Genome Version Description | GRCh37/hg19 |
| Human Genome RefSeq Accession | GCF_000001405.13 |
| Human Chromosome | chr5 |
| Cytogenetic Band | q13.3 |
| Human Strand | - |
| Human Integration Location Type | intronic |
| Hg19 Start | 73747006 |
| Hg19 End | 73747006 |
| Hg38 Start | 74451181 |
| Hg38 End | 74451181 |
| Junction Sequence | GAAGCATGCTAGGCAAAATTATCTCCCCAAATTAATCAACAAGTTTAGTGTATTTAACTGCACCAACAGGATGTATAAAAAAACATGGATATACAGTGGAAGTGCAGTTTGATGGAGACATATGCAATACAATGCATTATACAAACTGGAAACATATATATATTTGTGAAGAAGCATCAGTAAAT |
| Target Gene ▶ | |
| Target Gene | LINC01331 |
| Nearby Gene | - |
| Distance | - |
| Virus Information ▶ | |
| Virus Name | Human Papillomavirus |
| Virus Subtype Name | HPV16 |
| Virus Genome Accession | AF534061 |
| TaxonomyID | 10566 |
| Virus Abbreviation | HPV |
| Virus Genome | Human papillomavirus type 16 East Asian type, complete genome |
| Virus Genome Length | 7905 bp |
| Virus Breakpoint1 | 3054 |
| Virus Breakpoint2 | - |
| Virus Gene Name | HpV16gp4_E2 |
| Virus Region Type | - |
| Integrated Virus Sequence | - |
| ViMIC ID | - |
| Predicted VIS Effect ▶ | |
| Gene Id | ENSG00000248673.3 |
| Gene Name | LINC01331 |
| Region | intron |
| Impact | intronic_insertion |
| Transcript | Transcript 1: ENST00000663633.1, Transcript 2: ENST00000830054.1, Transcript 3: ENST00000830052.1, Transcript 4: ENST00000507781.2, Transcript 5: ENST00000830053.1, Transcript 6: ENST00000830065.1, Transcript 7: ENST00000715757.1, Transcript 8: ENST00000830066.1, Transcript 9: ENST00000830067.1, Transcript 10: ENST00000830058.1, Transcript 11: ENST00000830056.1, Transcript 12: ENST00000830071.1, Transcript 13: ENST00000830070.1, Transcript 14: ENST00000830057.1, Transcript 15: ENST00000830059.1, Transcript 16: ENST00000830068.1, Transcript 17: ENST00000830069.1, Transcript 18: ENST00000830055.1, Transcript 19: ENST00000715758.1, Transcript 20: ENST00000850665.1, Transcript 21: ENST00000830072.1, Transcript 22: ENST00000830061.1, Transcript 23: ENST00000830073.1, Transcript 24: ENST00000830060.1, Transcript 25: ENST00000830062.1, Transcript 26: ENST00000830074.1, Transcript 27: ENST00000830064.1, Transcript 28: ENST00000830063.1, Transcript 29: ENST00000657957.1 |
| AlphaGenome Analysis | |
| Window | chr5:74385645-74516717 |
| RNA-seq Change (±2kb) | Mean: -4.5341446821112186e-05 | Peak: 0.009002685546875 |
| ATAC Change (±2kb) | Mean: -0.005498840007930994 | Peak: 5.9662933349609375 |
| Interpretation | RNA-seq: no signal in region (REF≈0, ALT≈0) | Splice sites: no signal in region (REF≈0, ALT≈0) | ATAC: DECREASED 16.4% (REF=0.03, ALT=0.03) |
| Visualization | |
Center for Precision Health
McWilliams School of Biomedical Informatics at UTHealth Houston
7000 Fannin Street, Suite 600, Houston, TX 77030
Email: Zhongming Zhao, Ph.D