| Basic Information ▶ | |
| VISDB ID | TVIS20061128 |
|---|---|
| Fusion Name | HPV-ATG5 integration |
| Validated | No |
| Curated Way | Curated |
| Method | High-throughput Viral Integration Detection method |
| Wet Assay | Yes |
| Sample ID | - |
| Sample Name | S112 |
| Sample Type | Tumor |
| Age | 57 = 59; >57 = 50 |
| Gender | - |
| Disease Information ▶ | |
| Disease Name | Oropharyngeal squamous cell carcinoma |
| Disease Abbreviation | OPSCC |
| Cancer | Yes |
| Literature ▶ | |
| PubMed ID | 38279874 |
| Journal | Clinical and Translational Medicine |
| Published Year | 2024 |
| Human Genome ▶ | |
| Human Genome Version Description | GRCh37/hg19 |
| Human Genome RefSeq Accession | GCF_000001405.13 |
| Human Chromosome | chr6 |
| Cytogenetic Band | q21 |
| Human Strand | + |
| Human Integration Location Type | intronic |
| Hg19 Start | 106712532 |
| Hg19 End | 106712532 |
| Hg38 Start | 106264657 |
| Hg38 End | 106264657 |
| Junction Sequence | GAATATGTTGAAGTCCCTCACCTTCATTGTACAGTTTTGTGGGGTTGTTGTTGCATTTCTGATTGTTTTTGCTTTAGGTTTGGCTTCAACATATAATTGTTGTATACCATAACTTACTATTTTTTCTTTTTTATTTTTA |
| Target Gene ▶ | |
| Target Gene | ATG5 |
| Nearby Gene | - |
| Distance | - |
| Virus Information ▶ | |
| Virus Name | Human Papillomavirus |
| Virus Subtype Name | HPV16 |
| Virus Genome Accession | AF534061 |
| TaxonomyID | 10566 |
| Virus Abbreviation | HPV |
| Virus Genome | Human papillomavirus type 16 East Asian type, complete genome |
| Virus Genome Length | 7905 bp |
| Virus Breakpoint1 | 4126 |
| Virus Breakpoint2 | - |
| Virus Gene Name | HpV16gp7_L2;HpV16gp4_E2;HpV16gp5_E4;HpV16gp6_E5//upstream;downstream |
| Virus Region Type | - |
| Integrated Virus Sequence | - |
| ViMIC ID | - |
| Predicted VIS Effect ▶ | |
| Gene Id | ENSG00000057663.17 |
| Gene Name | ATG5 |
| Region | intron |
| Impact | intronic_insertion |
| Transcript | Transcript 1: ENST00000636437.1, Transcript 2: ENST00000636335.1, Transcript 3: ENST00000343245.7, Transcript 4: ENST00000360666.6, Transcript 5: ENST00000635758.2, Transcript 6: ENST00000369076.8, Transcript 7: ENST00000369070.5, Transcript 8: ENST00000939176.1, Transcript 9: ENST00000855918.1, Transcript 10: ENST00000613993.2, Transcript 11: ENST00000958078.1, Transcript 12: ENST00000855922.1, Transcript 13: ENST00000939177.1, Transcript 14: ENST00000958077.1, Transcript 15: ENST00000939178.1, Transcript 16: ENST00000855921.1, Transcript 17: ENST00000855920.1, Transcript 18: ENST00000855919.1, Transcript 19: ENST00000646025.1, Transcript 20: ENST00000476518.1 |
| SpliceAI Score | |
| Delta Scores | Acceptor Gain: 0.020 | Acceptor Loss: 0.000 | Donor Gain: 0.000 | Donor Loss: 0.000 |
| Delta Score Max | 0.020 |
| Delta Position at Max | -891 |
| Delta Score Flag | LOW |
| Gene | ATG5 |
| AlphaGenome Analysis | |
| Window | chr6:106199121-106330193 |
| RNA-seq Change (±2kb) | Mean: 0.0003195599711034447 | Peak: 0.06787109375 |
| ATAC Change (±2kb) | Mean: 0.0015267719281837344 | Peak: 0.36328125 |
| Interpretation | RNA-seq: no signal in region (REF≈0, ALT≈0) | Splice sites: no signal in region (REF≈0, ALT≈0) | ATAC: minimal change (delta=0.00) |
| Visualization | |
Center for Precision Health
McWilliams School of Biomedical Informatics at UTHealth Houston
7000 Fannin Street, Suite 600, Houston, TX 77030
Email: Zhongming Zhao, Ph.D