| Basic Information ▶ | |
| VISDB ID | TVIS20061813 |
|---|---|
| Fusion Name | HPV-ENSG00000287860 integration |
| Validated | No |
| Curated Way | Curated |
| Method | High-throughput Viral Integration Detection method |
| Wet Assay | Yes |
| Sample ID | - |
| Sample Name | S101 |
| Sample Type | Tumor |
| Age | 57 = 59; >57 = 50 |
| Gender | - |
| Disease Information ▶ | |
| Disease Name | Oropharyngeal squamous cell carcinoma |
| Disease Abbreviation | OPSCC |
| Cancer | Yes |
| Literature ▶ | |
| PubMed ID | 38279874 |
| Journal | Clinical and Translational Medicine |
| Published Year | 2024 |
| Human Genome ▶ | |
| Human Genome Version Description | GRCh37/hg19 |
| Human Genome RefSeq Accession | GCF_000001405.13 |
| Human Chromosome | chr7 |
| Cytogenetic Band | p22.1 |
| Human Strand | + |
| Human Integration Location Type | intronic |
| Hg19 Start | 7038717 |
| Hg19 End | 7038717 |
| Hg38 Start | 6999086 |
| Hg38 End | 6999086 |
| Junction Sequence | AGGTTGCTAATCAACTGACTTTAAGATTAGAAGAGTGTCCTGGATTATTCAAGTGTGCCCAATGTAATGACAAGGGTCTTTTAAGTGAGGACGAGGACCAGGGTCTCCACAATATACAATTATTGCTGATGCAGGTGAC |
| Target Gene ▶ | |
| Target Gene | ENSG00000287860 |
| Nearby Gene | - |
| Distance | - |
| Virus Information ▶ | |
| Virus Name | Human Papillomavirus |
| Virus Subtype Name | HPV16 |
| Virus Genome Accession | AF534061 |
| TaxonomyID | 10566 |
| Virus Abbreviation | HPV |
| Virus Genome | Human papillomavirus type 16 East Asian type, complete genome |
| Virus Genome Length | 7905 bp |
| Virus Breakpoint1 | 5528 |
| Virus Breakpoint2 | - |
| Virus Gene Name | HpV16gp7_L2 |
| Virus Region Type | - |
| Integrated Virus Sequence | - |
| ViMIC ID | - |
| Predicted VIS Effect ▶ | |
| Gene Id | ENSG00000287860.4 |
| Gene Name | ENSG00000287860 |
| Region | intron |
| Impact | intronic_insertion |
| Transcript | Transcript 1: ENST00000732036.1, Transcript 2: ENST00000732037.1, Transcript 3: ENST00000732038.1, Transcript 4: ENST00000701933.2, Transcript 5: ENST00000732040.1, Transcript 6: ENST00000732039.1, Transcript 7: ENST00000671358.1, Transcript 8: ENST00000702872.1, Transcript 9: ENST00000732041.1, Transcript 10: ENST00000732042.1, Transcript 11: ENST00000732043.1, Transcript 12: ENST00000732044.1, Transcript 13: ENST00000700809.1, Transcript 14: ENST00000732045.1, Transcript 15: ENST00000732046.1, Transcript 16: ENST00000732047.1, Transcript 17: ENST00000732048.1, Transcript 18: ENST00000732049.1, Transcript 19: ENST00000732050.1, Transcript 20: ENST00000732052.1, Transcript 21: ENST00000732051.1, Transcript 22: ENST00000732053.1, Transcript 23: ENST00000732055.1, Transcript 24: ENST00000732054.1, Transcript 25: ENST00000732056.1, Transcript 26: ENST00000732058.1 |
| AlphaGenome Analysis | |
| Window | chr7:6933550-7064622 |
| RNA-seq Change (±2kb) | Mean: -0.0003153127327095717 | Peak: 0.18359375 |
| ATAC Change (±2kb) | Mean: -0.00034071889240294695 | Peak: 0.476226806640625 |
| Interpretation | RNA-seq: no signal in region (REF≈0, ALT≈0) | Splice sites: no signal in region (REF≈0, ALT≈0) | ATAC: no signal in region (REF≈0, ALT≈0) |
| Visualization | |
Center for Precision Health
McWilliams School of Biomedical Informatics at UTHealth Houston
7000 Fannin Street, Suite 600, Houston, TX 77030
Email: Zhongming Zhao, Ph.D