| Basic Information ▶ | |
| VISDB ID | TVIS20063411 |
|---|---|
| Fusion Name | HPV-TCEA1P1 integration |
| Validated | No |
| Curated Way | Curated |
| Method | High-throughput Viral Integration Detection method |
| Wet Assay | Yes |
| Sample ID | - |
| Sample Name | S083 |
| Sample Type | Tumor |
| Age | 57 = 59; >57 = 50 |
| Gender | - |
| Disease Information ▶ | |
| Disease Name | Oropharyngeal squamous cell carcinoma |
| Disease Abbreviation | OPSCC |
| Cancer | Yes |
| Literature ▶ | |
| PubMed ID | 38279874 |
| Journal | Clinical and Translational Medicine |
| Published Year | 2024 |
| Human Genome ▶ | |
| Human Genome Version Description | GRCh37/hg19 |
| Human Genome RefSeq Accession | GCF_000001405.13 |
| Human Chromosome | chr9 |
| Cytogenetic Band | q22.33 |
| Human Strand | - |
| Human Integration Location Type | exonic |
| Hg19 Start | 99830159 |
| Hg19 End | 99830159 |
| Hg38 Start | 97067877 |
| Hg38 End | 97067877 |
| Junction Sequence | TGTACTCCCAGATATATCCTATTGGCCTCCCAAATCCAAGTTACCCAGTCAGCATCCTGCTTACTTCTGTGCCATCCTTCTCACTCCTCACGTAGAGAAACCCAGCTGTAATCATGCATGGAGATACACCTACATTGCATGAATATATGTTAGATTTGCAACCAGAGACAACTGATCTCTACTGTTATGAGCAATTAAGTGACAGCTCAGAGGAGGAGGATGAAAT |
| Target Gene ▶ | |
| Target Gene | TCEA1P1, CTSV |
| Nearby Gene | - |
| Distance | - |
| Virus Information ▶ | |
| Virus Name | Human Papillomavirus |
| Virus Subtype Name | HPV16 |
| Virus Genome Accession | AF534061 |
| TaxonomyID | 10566 |
| Virus Abbreviation | HPV |
| Virus Genome | Human papillomavirus type 16 East Asian type, complete genome |
| Virus Genome Length | 7905 bp |
| Virus Breakpoint1 | 536 |
| Virus Breakpoint2 | - |
| Virus Gene Name | HpV16gp1_E6 |
| Virus Region Type | - |
| Integrated Virus Sequence | - |
| ViMIC ID | - |
| Predicted VIS Effect ▶ | |
| Transcript | Transcript 1: ENST00000930701.1, Transcript 2: ENST00000681517.1, Transcript 3: ENST00000679551.1, Transcript 4: ENST00000449716.2 |
| Transcript 1 Gene Id | ENSG00000136943.13 |
| Transcript 1 Gene Name | CTSV |
| Transcript 1 Region | intron |
| Transcript 1 Impact | intronic_insertion |
| Transcript 2 Gene Id | ENSG00000136943.13 |
| Transcript 2 Gene Name | CTSV |
| Transcript 2 Region | intron |
| Transcript 2 Impact | intronic_insertion |
| Transcript 3 Gene Id | ENSG00000136943.13 |
| Transcript 3 Gene Name | CTSV |
| Transcript 3 Region | intron |
| Transcript 3 Impact | intronic_insertion |
| Transcript 4 Gene Id | ENSG00000197214.5 |
| Transcript 4 Gene Name | TCEA1P1 |
| Transcript 4 Region | exon_non_coding |
| Transcript 4 Impact | noncoding_exon_insertion |
| AlphaGenome Analysis | |
| Window | chr9:97002341-97133413 |
| RNA-seq Change (±2kb) | Mean: 1.8477510820957832e-05 | Peak: 0.0367279052734375 |
| ATAC Change (±2kb) | Mean: 0.001234946888871491 | Peak: 0.958770751953125 |
| Interpretation | RNA-seq: no signal in region (REF≈0, ALT≈0) | Splice sites: no signal in region (REF≈0, ALT≈0) | ATAC: minimal change 7.2% |
| Visualization | |
Center for Precision Health
McWilliams School of Biomedical Informatics at UTHealth Houston
7000 Fannin Street, Suite 600, Houston, TX 77030
Email: Zhongming Zhao, Ph.D